Gene detail

Detail information of GWHGAAZE013612

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP13171.1	1.99467E-40	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q6NKP9\|AMSH2_ARATH	2E-39	AMSH-like ubiquitin thioesterase 2
trEMBL	tr\|A0A068UXQ9\|A0A068UXQ9_COFCA	7E-41	Coffea canephora DH200=94 genomic scaffold, scaffold_74 {ECO:0000313\|EMBL:CDP13171.1}
TAIR10	AT1G10600.1	3E-32	associated molecule with the SH3 domain of STAM 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	105337405	105338956	+
GWHAAZE00000003	mRNA	105337405	105338956	+
GWHAAZE00000003	exon	105337405	105337674	+
GWHAAZE00000003	exon	105338122	105338186	+
GWHAAZE00000003	exon	105338289	105338361	+
GWHAAZE00000003	exon	105338466	105338518	+
GWHAAZE00000003	exon	105338782	105338956	+
GWHAAZE00000003	five_prime_UTR	105337405	105337674	+
GWHAAZE00000003	five_prime_UTR	105338122	105338186	+
GWHAAZE00000003	five_prime_UTR	105338289	105338322	+
GWHAAZE00000003	CDS	105338323	105338361	+
GWHAAZE00000003	CDS	105338466	105338518	+
GWHAAZE00000003	CDS	105338782	105338956	+

Transcript Sequence
>GWHTAAZE013626 CAAGTAAGGATCTGGAGACCTGTGGGGTTCTCGGTGCTTCTCTTGTAAGACTTTGTGGCTTGTGGCATGCCCATAAGTGCTTGTATCTTTGAAATGTTTAATCTCAGAAACTATTTTTCTTCAATCCCCATCCCCAACCTCCGGTCCCCCTTCTTGGTGGGTTTGACTAAAGGCTGATCTGTTTTCTCCCTCGTTTGTACAGAAAGAGGGCACCTTTTATGTTACGACTCTGATAATACCCAAGCAAGAATCGTCTTCCAGCTCTGTAAGTGCCAAGCTCTAAACGAGGAGGAAATATTTGCTATACAAAATGAACAGTCAGTTTATCCTATTGGGTATCTTCAGACACATCCTTCTCAGAGTTGTTTCATGTCATCAGTTGATTTGCACACCCAATATTCGTATCAGGTAATGGTACGCGAGGCTGTTGCTATTGTCATGGCTCCAACCGATAAATCCAGGGGCTCTGGGGTATTCCGACTATCTGAACCTGGTGGGATGAGTGTGTTAAGGGAGTGCCAGGAACATGGGTATCATCCTCATAGAGAACCAACTGATGGAAGCAATGTATATGACCACTGCTCAAATGTTTATATTAACCCGTATCTGAGATTAGAAATATGCGACTTACGTTGA

Network for GWHGAAZE013612

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K11866	STAMBP, AMSH	Endocytosis	map04144

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.301
	SRR3591706	second leaf	1.107
	SRR3591707	mature leaf	3.021
	SRR3591708	Shoot apex	3.683
	SRR3591709	Stem	6.604
	SRR3591710	White floral bud	14.769
	SRR3591711	White flower	22.131
	SRR3591712	Green floral bud	8.026
	SRR3591713	Yellow flower	34.787
SRP173429	SRR8316895	Juvenile bud stage	5.460
	SRR8316896	Juvenile bud stage	9.216
	SRR8316897	Juvenile bud stage	4.054
	SRR8316894	Third green stage	3.952
	SRR8316900	Third green stage	8.663
	SRR8316901	Third green stage	10.347
	SRR8316898	Complete white stage	5.020
	SRR8316899	Complete white stage	18.610
	SRR8316903	Complete white stage	11.886
	SRR8316902	Silver flowering stage	9.414
	SRR8316904	Silver flowering stage	11.106
	SRR8316905	Silver flowering stage	6.005
	SRR8316906	Gold flowering stage	16.295
	SRR8316907	Gold flowering stage	18.942
	SRR8316908	Gold flowering stage	17.660
SRP132670	SRR6706286	Control	6.794
	SRR6706287	Light intensity 50%	7.454
	SRR6706288	Light intensity 20%	7.720
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	10.768
	CNS0095593	Slightly white alabastrum(diploid) 2	13.343
	CNS0095594	Slightly white alabastrum(diploid) 3	11.790
	CNS0095595	Whole white alabastrum(diploid) 2	8.995
	CNS0095596	Whole white alabastrum(diploid) 3	9.387
	CNS0095597	Whole white alabastrum(diploid) 4	8.475
	CNS0095598	Silvery flower (diploied) 1	18.002
	CNS0095599	Silvery flower (diploied) 2	21.430
	CNS0095600	Silvery flower (diploied) 3	14.465
	CNS0095601	Golden flower (diploid) 1	17.267
	CNS0095602	Golden flower (diploid) 2	13.068
	CNS0095603	Golden flower (diploid) 3	17.426
	CNS0095604	Slightly white alabastrum(tetraploid) 1	9.847
	CNS0095605	Slightly white alabastrum(tetraploid) 2	10.551
	CNS0095606	Slightly white alabastrum(tetraploid) 3	7.374
	CNS0095607	Whole white alabastrum(tetraploid) 1	11.502
	CNS0095608	Whole white alabastrum(tetraploid) 2	11.497
	CNS0095609	Whole white alabastrum(tetraploid) 3	11.511
	CNS0095610	Silvery flower (tetraploid) 1	21.524
	CNS0095611	Silvery flower (tetraploid) 2	19.871
	CNS0095612	Silvery flower (tetraploid) 3	36.879
	CNS0095613	Golden flower (tetraploid) 1	17.136
	CNS0095614	Golden flower (tetraploid) 2	16.203
	CNS0095615	Golden flower (tetraploid) 3	30.684
CRA001975	CRR073297	Stem 1	3.924
	CRR073298	Stem 2	5.017
	CRR073299	Stem 3	2.658
	CRR073300	Leaf 1	6.707
	CRR073301	Leaf 2	6.105
	CRR073302	Leaf 3	3.014
	CRR073303	Juvenile bud 1	4.211
	CRR073304	Juvenile bud 2	4.119
	CRR073305	Juvenile bud 3	5.596
	CRR073306	Third green 1	1.924
	CRR073307	Third green 2	2.320
	CRR073308	Third green 3	2.497
	CRR073309	Second white 1	8.577
	CRR073310	Second white 2	7.196
	CRR073311	Second white 3	5.685
	CRR073312	Silver flowering 1	5.575
	CRR073313	Silver flowering 2	6.649
	CRR073314	Silver flowering 3	7.012
	CRR073315	Gold flowering 1	1.214
	CRR073316	Gold flowering 2	2.116
	CRR073317	Gold flowering 3	0.603
	CRR073318	Tawny withering 1	7.771
	CRR073319	Tawny withering 2	6.015
	CRR073320	Tawny withering 3	6.851