Gene detail

Detail information of GWHGAAZE013578

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP00229.1	1.207E-86	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q9ZWS9\|ARR3_ARATH	4E-75	Two-component response regulator ARR3
trEMBL	tr\|A0A068TWC5\|A0A068TWC5_COFCA	5E-87	Coffea canephora DH200=94 genomic scaffold, scaffold_5 {ECO:0000313\|EMBL:CDP00229.1}
TAIR10	AT1G10470.1	6E-51	response regulator 4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	104700238	104701158	-
GWHAAZE00000003	mRNA	104700238	104701158	-
GWHAAZE00000003	exon	104701020	104701158	-
GWHAAZE00000003	exon	104700849	104700925	-
GWHAAZE00000003	exon	104700686	104700763	-
GWHAAZE00000003	exon	104700511	104700581	-
GWHAAZE00000003	exon	104700238	104700334	-
GWHAAZE00000003	CDS	104701020	104701158	-
GWHAAZE00000003	CDS	104700849	104700925	-
GWHAAZE00000003	CDS	104700686	104700763	-
GWHAAZE00000003	CDS	104700511	104700581	-
GWHAAZE00000003	CDS	104700238	104700334	-

Transcript Sequence
>GWHTAAZE013592 ATGTCGGAGGAGATTGATGGCTTTGGTGACGTGTCATCGTCATCGTCTGATTCTCATGATGTTCATGTGCTTGCCGTTGATGACAGTCTTGTTGATCGGAAAGTCATCGAACGATTGCTTAAAATCACTTCCTGTAAAGTGACAGCTGTGGATAGTGGAAGGAGAGCTTTGCAGTTATTAGGATTGGACGAGGAGAAGAGCTCCGTTGGTTTCCATGAAATGAAGGTGGATATGATAATCACAGACTATTGTATGCCCGGAATGACTGGTTACGAATTGCTTAAGAAGATCAAGGAATCATCCACTTTCAGAGAGGTACCGGTTGTGATTATGTCTTCTGAAAATGTTTTGGCACGGATTGACAGGTGTTTGGAGGAAGGAGCGGAGGATTTCATAGTAAAGCCAGTAAAATTGGCAGATGTGAAAAGATTGAAGGATTACATGTTTGGAGATGATGGAGTT

Network for GWHGAAZE013578

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00072.25	Response_reg	23	141	7.50E-24

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	Others

KEGG pathway

KO	Enzyme	pathway	mapID
K14492	ARR-A	Plant hormone signal transduction	map04075

Gene Ontology

GO term	Ontology	Name
GO:0000160	biological_process	phosphorelay signal transduction system

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	5.030
	SRR3591706	second leaf	1.311
	SRR3591707	mature leaf	3.952
	SRR3591708	Shoot apex	3.368
	SRR3591709	Stem	13.957
	SRR3591710	White floral bud	2.881
	SRR3591711	White flower	7.863
	SRR3591712	Green floral bud	3.659
	SRR3591713	Yellow flower	0.954
SRP173429	SRR8316895	Juvenile bud stage	3.371
	SRR8316896	Juvenile bud stage	8.339
	SRR8316897	Juvenile bud stage	2.094
	SRR8316894	Third green stage	7.440
	SRR8316900	Third green stage	17.919
	SRR8316901	Third green stage	20.530
	SRR8316898	Complete white stage	1.436
	SRR8316899	Complete white stage	10.417
	SRR8316903	Complete white stage	3.136
	SRR8316902	Silver flowering stage	0.149
	SRR8316904	Silver flowering stage	3.252
	SRR8316905	Silver flowering stage	0.112
	SRR8316906	Gold flowering stage	1.235
	SRR8316907	Gold flowering stage	1.664
	SRR8316908	Gold flowering stage	2.816
SRP132670	SRR6706286	Control	8.362
	SRR6706287	Light intensity 50%	8.214
	SRR6706288	Light intensity 20%	7.261
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	14.063
	CNS0095593	Slightly white alabastrum(diploid) 2	8.368
	CNS0095594	Slightly white alabastrum(diploid) 3	17.476
	CNS0095595	Whole white alabastrum(diploid) 2	8.758
	CNS0095596	Whole white alabastrum(diploid) 3	6.975
	CNS0095597	Whole white alabastrum(diploid) 4	3.739
	CNS0095598	Silvery flower (diploied) 1	11.642
	CNS0095599	Silvery flower (diploied) 2	2.930
	CNS0095600	Silvery flower (diploied) 3	2.681
	CNS0095601	Golden flower (diploid) 1	2.011
	CNS0095602	Golden flower (diploid) 2	2.205
	CNS0095603	Golden flower (diploid) 3	1.829
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.574
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.213
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.544
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.904
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.944
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.910
	CNS0095610	Silvery flower (tetraploid) 1	3.360
	CNS0095611	Silvery flower (tetraploid) 2	1.572
	CNS0095612	Silvery flower (tetraploid) 3	1.603
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.501
	CNS0095615	Golden flower (tetraploid) 3	1.442
CRA001975	CRR073297	Stem 1	9.542
	CRR073298	Stem 2	15.641
	CRR073299	Stem 3	8.626
	CRR073300	Leaf 1	5.933
	CRR073301	Leaf 2	9.703
	CRR073302	Leaf 3	8.014
	CRR073303	Juvenile bud 1	3.738
	CRR073304	Juvenile bud 2	0.830
	CRR073305	Juvenile bud 3	0.803
	CRR073306	Third green 1	0.302
	CRR073307	Third green 2	1.464
	CRR073308	Third green 3	1.658
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.091
	CRR073311	Second white 3	0.189
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.164
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	1.989
	CRR073316	Gold flowering 2	0.579
	CRR073317	Gold flowering 3	0.506
	CRR073318	Tawny withering 1	11.782
	CRR073319	Tawny withering 2	12.864
	CRR073320	Tawny withering 3	12.383