Gene detail

Detail information of GWHGAAZE013435

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010261402.1	5.00315E-40	PREDICTED: heat shock protein 83-like [Nelumbo nucifera]
Swissprot	tr\|Q9STX5\|ENPL_ARATH	1E-14	Endoplasmin homolog (Precursor)
trEMBL	tr\|A0A067FSA0\|A0A067FSA0_CITSI	2E-38	Uncharacterized protein {ECO:0000313\|EMBL:KDO70244.1} (Fragment)
TAIR10	AT2G04030.2	2E-29	Chaperone protein htpG family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	102630310	102630888	-
GWHAAZE00000003	mRNA	102630310	102630888	-
GWHAAZE00000003	exon	102630310	102630426	-
GWHAAZE00000003	exon	102630604	102630693	-
GWHAAZE00000003	exon	102630787	102630888	-
GWHAAZE00000003	CDS	102630787	102630888	-
GWHAAZE00000003	CDS	102630604	102630693	-
GWHAAZE00000003	CDS	102630310	102630426	-

Transcript Sequence
>GWHTAAZE013449 ATGAAAGCACGGACTCTTGGAGACACTTCAGGTTTGGAGTTTATGAGGGGGAGAAGGATATTGGAGGTTAACCCCGATCATCCAATCATCAAAGACCTAAACGCTGCATGCAAGAATGCACCTGAAAGCACCGAAGCGAAGAGAGCCGTGGACCTCTTATACAATACTGCATTGATCTCCAGTGGATTCTCTGGGGGCATGGATGATGATTCTACTACGGTGTCAGATGCGGGCTCCACTGAATCCATGGATGCTGAAGTTGTTGAGCCATCGGAAGTGAGGACAGAGAAAGATCCTTGGAGTTCTTGA

Network for GWHGAAZE013435

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00183.19	HSP90	1	68	7.20E-15

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K09487	HSP90B, TRA1	Protein processing in endoplasmic reticulum	map04141
		PI3K-Akt signaling pathway	map04151
		IL-17 signaling pathway	map04657
		Estrogen signaling pathway	map04915
		Thyroid hormone synthesis	map04918
		Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0006457	biological_process	protein folding
GO:0005524	molecular_function	ATP binding
GO:0051082	molecular_function	unfolded protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.052
	SRR3591706	second leaf	3.341
	SRR3591707	mature leaf	2.745
	SRR3591708	Shoot apex	8.859
	SRR3591709	Stem	4.787
	SRR3591710	White floral bud	1.685
	SRR3591711	White flower	1.955
	SRR3591712	Green floral bud	0.769
	SRR3591713	Yellow flower	0.874
SRP173429	SRR8316895	Juvenile bud stage	2.158
	SRR8316896	Juvenile bud stage	2.562
	SRR8316897	Juvenile bud stage	0.968
	SRR8316894	Third green stage	0.268
	SRR8316900	Third green stage	2.048
	SRR8316901	Third green stage	1.272
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.256
	SRR8316903	Complete white stage	0.423
	SRR8316902	Silver flowering stage	0.222
	SRR8316904	Silver flowering stage	0.301
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.707
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	1.003
SRP132670	SRR6706286	Control	1.583
	SRR6706287	Light intensity 50%	1.234
	SRR6706288	Light intensity 20%	1.271
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	5.808
	CNS0095593	Slightly white alabastrum(diploid) 2	6.510
	CNS0095594	Slightly white alabastrum(diploid) 3	9.707
	CNS0095595	Whole white alabastrum(diploid) 2	4.767
	CNS0095596	Whole white alabastrum(diploid) 3	5.504
	CNS0095597	Whole white alabastrum(diploid) 4	2.637
	CNS0095598	Silvery flower (diploied) 1	7.574
	CNS0095599	Silvery flower (diploied) 2	4.702
	CNS0095600	Silvery flower (diploied) 3	0.558
	CNS0095601	Golden flower (diploid) 1	6.528
	CNS0095602	Golden flower (diploid) 2	1.202
	CNS0095603	Golden flower (diploid) 3	1.032
	CNS0095604	Slightly white alabastrum(tetraploid) 1	6.890
	CNS0095605	Slightly white alabastrum(tetraploid) 2	7.947
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.190
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.180
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.043
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.087
	CNS0095610	Silvery flower (tetraploid) 1	0.783
	CNS0095611	Silvery flower (tetraploid) 2	1.136
	CNS0095612	Silvery flower (tetraploid) 3	3.233
	CNS0095613	Golden flower (tetraploid) 1	1.068
	CNS0095614	Golden flower (tetraploid) 2	2.603
	CNS0095615	Golden flower (tetraploid) 3	0.324
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	1.496
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.219
	CRR073301	Leaf 2	0.367
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.501
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.274
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.132
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.129
	CRR073319	Tawny withering 2	0.323
	CRR073320	Tawny withering 3	1.148