Gene detail

Detail information of GWHGAAZE013424

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011077776.1	3.48856E-82	PREDICTED: basic leucine zipper 43-like [Sesamum indicum]
Swissprot	tr\|Q9FMC2\|BZP43_ARATH	8E-41	Basic leucine zipper 43
trEMBL	tr\|A0A068TW22\|A0A068TW22_COFCA	1E-80	Coffea canephora DH200=94 genomic scaffold, scaffold_5 {ECO:0000313\|EMBL:CDP00505.1}
TAIR10	AT3G30530.1	1E-29	basic leucine-zipper 42

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	102464821	102465372	-
GWHAAZE00000003	mRNA	102464821	102465372	-
GWHAAZE00000003	exon	102464821	102465372	-
GWHAAZE00000003	CDS	102464821	102465372	-

Transcript Sequence
>GWHTAAZE013438 ATGTTTTTCCCATCAGATATTGGCCAAATCCCCTCCCTAACTCCTCCCGAAAACCAATCCCCTTTTCCCACCAGCTGGTTAACCAACTTACCAAATTATCAAACATCTCTCCCTCTTTATGAGTTCACTTCACAGTCCTATTGTCCTAGTAATAACTCAACCTCTGACGAAGCAGAGGAGCACCCACTTAGCATCCTTGATGAGAGGAGGCGAAGGAGAATGATTTCTAATAGAGAATCGGCTCGAAGGTCGCGTATGAGGAAGCAGAGACACCTAGATGAGCTATGGTCACAGGTGGTTCGTCTTAGAACCGAGAATCACAGCCTTGTAGACAAGTTGAATCATGTATCGGAGTGCCATGATAGGGCTCTTCAAGAGAATGCAAGGCTAAAGGAAGAAGTTACCGACCTTCGCCAAATGCTAACTGACCTCCAACTTGCAAGTACTTACACTGCTTTGAGAGACCTTGAGGAGGTCCCTTGCAACACAGCTCATCTCAGGGTTGAATCTTCAAACAAAAGTACCACTACCTCCAGGAATCTGCTTCATTGA

Network for GWHGAAZE013424

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00170.22	bZIP_1	69	118	1.40E-11

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	bZIP

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.302
	SRR3591706	second leaf	0.502
	SRR3591707	mature leaf	0.101
	SRR3591708	Shoot apex	0.784
	SRR3591709	Stem	2.686
	SRR3591710	White floral bud	0.358
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.648
	SRR3591713	Yellow flower	1.147
SRP173429	SRR8316895	Juvenile bud stage	1.420
	SRR8316896	Juvenile bud stage	1.057
	SRR8316897	Juvenile bud stage	0.731
	SRR8316894	Third green stage	0.990
	SRR8316900	Third green stage	2.431
	SRR8316901	Third green stage	2.975
	SRR8316898	Complete white stage	0.488
	SRR8316899	Complete white stage	3.631
	SRR8316903	Complete white stage	1.046
	SRR8316902	Silver flowering stage	0.225
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.095
	SRR8316906	Gold flowering stage	0.796
	SRR8316907	Gold flowering stage	0.222
	SRR8316908	Gold flowering stage	0.953
SRP132670	SRR6706286	Control	3.167
	SRR6706287	Light intensity 50%	4.347
	SRR6706288	Light intensity 20%	4.581
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.705
	CNS0095593	Slightly white alabastrum(diploid) 2	2.924
	CNS0095594	Slightly white alabastrum(diploid) 3	0.377
	CNS0095595	Whole white alabastrum(diploid) 2	2.384
	CNS0095596	Whole white alabastrum(diploid) 3	1.158
	CNS0095597	Whole white alabastrum(diploid) 4	2.765
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.294
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.370
	CNS0095603	Golden flower (diploid) 3	0.372
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.462
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.279
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.938
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.645
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.129
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.908
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.070
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.158
	CNS0095614	Golden flower (tetraploid) 2	1.157
	CNS0095615	Golden flower (tetraploid) 3	0.252
CRA001975	CRR073297	Stem 1	1.113
	CRR073298	Stem 2	1.590
	CRR073299	Stem 3	0.381
	CRR073300	Leaf 1	2.126
	CRR073301	Leaf 2	2.618
	CRR073302	Leaf 3	5.881
	CRR073303	Juvenile bud 1	7.566
	CRR073304	Juvenile bud 2	3.784
	CRR073305	Juvenile bud 3	12.792
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.414
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.108
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.710
	CRR073315	Gold flowering 1	0.129
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.589
	CRR073319	Tawny withering 2	1.104
	CRR073320	Tawny withering 3	1.099