Gene detail

Detail information of GWHGAAZE013418

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AIS20829.1	2.6662E-100	SAMDC3 [Pyrus x bretschneideri]
Swissprot	tr\|Q9AXE3\|DCAM_DAUCA	2E-97	S-adenosylmethionine decarboxylase beta chain (Precursor)
trEMBL	tr\|A0A096ZJV8\|A0A096ZJV8_9ROSA	1E-100	SAMDC3 {ECO:0000313\|EMBL:AIS20829.1}
TAIR10	AT3G02470.4	4E-66	S-adenosylmethionine decarboxylase

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	102385744	102386394	+
GWHAAZE00000003	mRNA	102385744	102386394	+
GWHAAZE00000003	exon	102385744	102386394	+
GWHAAZE00000003	CDS	102385744	102386394	+

Transcript Sequence
>GWHTAAZE013432 ATGGGTTCAGGCAGCAAGGCTTACATAATGGGTGGGCCCCAAGACCCACAGAAGTGGCACGTGTACTCTGCCTGTGCTGGGTCTGCGTGCTTTTTTGAACCTGTTTACACGCTCGAGATGTGCATGACCGGTTTGGATAGGGATAAAGCCTCGGTATTTTACAAAAGCCAATTTGGCTTGGCAAACCTGATGACTGATAACTCTGGCATAAGGAAAATTCTTCCAGATTCTGAGATTTGTGATTTTGAGTTTGATCCATGTGGTTATTCCATGAACGCCGTTGAAAGTAGTGCAATATCTACCATTCATGTCACACCTGAAGATGTTTTTAGCTACGCAAGCTTTGAAGCGATTGGGTATGATCCGAAGGCAGTTTCCATTGACCAGCTGGTCACAAGGGTGTTGGCTTGTTTTCAACCGAGCAATTTCTCAGTAGCCGTGCATGCTTCTGTTGCGTGTGAATTACTTGAGGAAACATGTTTTCTGGATGTGAAGGGTTACTGTATGGGGGAGAGGAGTTGTGAAGAGCTCGGAAAGGATGGTGGCTCAACTGTTTACCAGAAGTTTGTGAAGACTGCTGGAAGCTGTGGATCTCCTAGGTCTGTCTTGAAATTCAGCTGGAAAGAGGAAGAGAGAGAAGAAGAGTGGTAG

Network for GWHGAAZE013418

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01536.17	SAM_decarbox	5	189	1.30E-46

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01611	speD, AMD1	Metabolic pathways	map01100
		Cysteine and methionine metabolism	map00270
		Arginine and proline metabolism	map00330

Gene Ontology

GO term	Ontology	Name
GO:0008295	biological_process	spermidine biosynthetic process
GO:0006597	biological_process	spermine biosynthetic process
GO:0004014	molecular_function	adenosylmethionine decarboxylase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	24.897
	SRR3591706	second leaf	13.489
	SRR3591707	mature leaf	14.786
	SRR3591708	Shoot apex	24.257
	SRR3591709	Stem	25.450
	SRR3591710	White floral bud	22.430
	SRR3591711	White flower	22.897
	SRR3591712	Green floral bud	22.006
	SRR3591713	Yellow flower	20.180
SRP173429	SRR8316895	Juvenile bud stage	17.795
	SRR8316896	Juvenile bud stage	24.132
	SRR8316897	Juvenile bud stage	12.529
	SRR8316894	Third green stage	9.566
	SRR8316900	Third green stage	19.753
	SRR8316901	Third green stage	22.712
	SRR8316898	Complete white stage	8.268
	SRR8316899	Complete white stage	24.732
	SRR8316903	Complete white stage	13.538
	SRR8316902	Silver flowering stage	8.331
	SRR8316904	Silver flowering stage	9.872
	SRR8316905	Silver flowering stage	5.047
	SRR8316906	Gold flowering stage	13.704
	SRR8316907	Gold flowering stage	16.637
	SRR8316908	Gold flowering stage	16.035
SRP132670	SRR6706286	Control	24.062
	SRR6706287	Light intensity 50%	19.850
	SRR6706288	Light intensity 20%	21.901
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	34.927
	CNS0095593	Slightly white alabastrum(diploid) 2	32.582
	CNS0095594	Slightly white alabastrum(diploid) 3	33.137
	CNS0095595	Whole white alabastrum(diploid) 2	25.644
	CNS0095596	Whole white alabastrum(diploid) 3	20.948
	CNS0095597	Whole white alabastrum(diploid) 4	25.321
	CNS0095598	Silvery flower (diploied) 1	30.294
	CNS0095599	Silvery flower (diploied) 2	29.466
	CNS0095600	Silvery flower (diploied) 3	17.924
	CNS0095601	Golden flower (diploid) 1	24.584
	CNS0095602	Golden flower (diploid) 2	21.721
	CNS0095603	Golden flower (diploid) 3	16.838
	CNS0095604	Slightly white alabastrum(tetraploid) 1	30.333
	CNS0095605	Slightly white alabastrum(tetraploid) 2	29.926
	CNS0095606	Slightly white alabastrum(tetraploid) 3	30.360
	CNS0095607	Whole white alabastrum(tetraploid) 1	21.984
	CNS0095608	Whole white alabastrum(tetraploid) 2	21.667
	CNS0095609	Whole white alabastrum(tetraploid) 3	25.216
	CNS0095610	Silvery flower (tetraploid) 1	20.088
	CNS0095611	Silvery flower (tetraploid) 2	21.712
	CNS0095612	Silvery flower (tetraploid) 3	23.877
	CNS0095613	Golden flower (tetraploid) 1	20.627
	CNS0095614	Golden flower (tetraploid) 2	19.090
	CNS0095615	Golden flower (tetraploid) 3	18.934
CRA001975	CRR073297	Stem 1	31.950
	CRR073298	Stem 2	26.936
	CRR073299	Stem 3	11.652
	CRR073300	Leaf 1	33.707
	CRR073301	Leaf 2	36.169
	CRR073302	Leaf 3	15.358
	CRR073303	Juvenile bud 1	14.867
	CRR073304	Juvenile bud 2	8.398
	CRR073305	Juvenile bud 3	13.905
	CRR073306	Third green 1	5.602
	CRR073307	Third green 2	4.104
	CRR073308	Third green 3	4.293
	CRR073309	Second white 1	3.864
	CRR073310	Second white 2	4.311
	CRR073311	Second white 3	4.589
	CRR073312	Silver flowering 1	3.838
	CRR073313	Silver flowering 2	1.889
	CRR073314	Silver flowering 3	2.703
	CRR073315	Gold flowering 1	5.007
	CRR073316	Gold flowering 2	11.093
	CRR073317	Gold flowering 3	2.196
	CRR073318	Tawny withering 1	12.462
	CRR073319	Tawny withering 2	19.418
	CRR073320	Tawny withering 3	14.228