Gene detail

Detail information of GWHGAAZE013369

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009602361.1	4.92719E-55	PREDICTED: ethylene-responsive transcription factor ERF118-like [Nicotiana tomentosiformis]
Swissprot	tr\|Q9CA27\|EF118_ARATH	2E-28	Ethylene-responsive transcription factor ERF118
trEMBL	tr\|K4BXB9\|K4BXB9_SOLLC	9E-53	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc05g009450.1.1}
TAIR10	AT1G68550.2	6E-23	Integrase-type DNA-binding superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	101591888	101592382	-
GWHAAZE00000003	mRNA	101591888	101592382	-
GWHAAZE00000003	exon	101591888	101592382	-
GWHAAZE00000003	CDS	101591888	101592382	-

Transcript Sequence
>GWHTAAZE013383 ATGCCAGAGCGGAAAAAATCCAGAGCATACTCTGCTGACCAGAACGCCAAATCCATGAGAAAAATTCGCGTAATCTGTTACGATCCTGACGCTACTGATTCCTCAGACGACGAGGGAATCAACAGGGTGTTGGAATCTAAGCGTATGATTCGAGAGATTATGCTCCCAAACGGCGATTCTCAGCAATCTGTCAAAGCTTTGGAGATGGAGAATTCCTATCAAGATAGCAACAACGGCCATAAAAAGAAAAAGAGGGCTGTGGCCAAAACCGCGAACAGTAACGATAGACCACGGCTCTCAAAATTCAGAGGCGTTCGACAGCGAAAATGGGGGAAATGGGCAGCCGAAATACGTGACCCTTTTAAAGGAAGGAGGGTCTGGTTGGGCACTTACAACACTGCTGAAGAAGCCGCCAACGCTTACGATATAAAGAAGCTCGAGTTTGAGGCCATGGCTGCAAACTCTTCTTCACTTGCAGCTACAGCTACTACTACT

Network for GWHGAAZE013369

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	100	149	6.20E-14

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	42.043
	SRR3591706	second leaf	47.702
	SRR3591707	mature leaf	20.754
	SRR3591708	Shoot apex	54.495
	SRR3591709	Stem	28.729
	SRR3591710	White floral bud	11.482
	SRR3591711	White flower	24.829
	SRR3591712	Green floral bud	14.347
	SRR3591713	Yellow flower	9.561
SRP173429	SRR8316895	Juvenile bud stage	22.525
	SRR8316896	Juvenile bud stage	17.405
	SRR8316897	Juvenile bud stage	8.642
	SRR8316894	Third green stage	6.002
	SRR8316900	Third green stage	13.063
	SRR8316901	Third green stage	14.854
	SRR8316898	Complete white stage	1.003
	SRR8316899	Complete white stage	19.012
	SRR8316903	Complete white stage	6.122
	SRR8316902	Silver flowering stage	3.112
	SRR8316904	Silver flowering stage	3.194
	SRR8316905	Silver flowering stage	1.163
	SRR8316906	Gold flowering stage	5.383
	SRR8316907	Gold flowering stage	4.796
	SRR8316908	Gold flowering stage	8.619
SRP132670	SRR6706286	Control	34.776
	SRR6706287	Light intensity 50%	31.067
	SRR6706288	Light intensity 20%	29.991
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	16.258
	CNS0095593	Slightly white alabastrum(diploid) 2	13.949
	CNS0095594	Slightly white alabastrum(diploid) 3	16.952
	CNS0095595	Whole white alabastrum(diploid) 2	14.515
	CNS0095596	Whole white alabastrum(diploid) 3	6.689
	CNS0095597	Whole white alabastrum(diploid) 4	11.763
	CNS0095598	Silvery flower (diploied) 1	26.216
	CNS0095599	Silvery flower (diploied) 2	28.576
	CNS0095600	Silvery flower (diploied) 3	16.179
	CNS0095601	Golden flower (diploid) 1	29.646
	CNS0095602	Golden flower (diploid) 2	27.414
	CNS0095603	Golden flower (diploid) 3	20.837
	CNS0095604	Slightly white alabastrum(tetraploid) 1	16.403
	CNS0095605	Slightly white alabastrum(tetraploid) 2	12.788
	CNS0095606	Slightly white alabastrum(tetraploid) 3	33.806
	CNS0095607	Whole white alabastrum(tetraploid) 1	5.260
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.532
	CNS0095609	Whole white alabastrum(tetraploid) 3	8.765
	CNS0095610	Silvery flower (tetraploid) 1	12.568
	CNS0095611	Silvery flower (tetraploid) 2	9.226
	CNS0095612	Silvery flower (tetraploid) 3	3.528
	CNS0095613	Golden flower (tetraploid) 1	2.558
	CNS0095614	Golden flower (tetraploid) 2	6.537
	CNS0095615	Golden flower (tetraploid) 3	2.332
CRA001975	CRR073297	Stem 1	34.650
	CRR073298	Stem 2	25.544
	CRR073299	Stem 3	34.491
	CRR073300	Leaf 1	12.138
	CRR073301	Leaf 2	15.341
	CRR073302	Leaf 3	10.211
	CRR073303	Juvenile bud 1	11.571
	CRR073304	Juvenile bud 2	3.504
	CRR073305	Juvenile bud 3	18.696
	CRR073306	Third green 1	13.766
	CRR073307	Third green 2	13.929
	CRR073308	Third green 3	19.562
	CRR073309	Second white 1	16.168
	CRR073310	Second white 2	6.309
	CRR073311	Second white 3	9.749
	CRR073312	Silver flowering 1	4.903
	CRR073313	Silver flowering 2	8.659
	CRR073314	Silver flowering 3	4.236
	CRR073315	Gold flowering 1	51.177
	CRR073316	Gold flowering 2	56.594
	CRR073317	Gold flowering 3	68.492
	CRR073318	Tawny withering 1	71.813
	CRR073319	Tawny withering 2	56.091
	CRR073320	Tawny withering 3	74.393