Gene detail

Detail information of GWHGAAZE013260

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008387012.1	1.56304E-49	PREDICTED: signal recognition particle 54 kDa protein, chloroplastic-like [Malus domestica]
Swissprot	tr\|P37107\|SR54C_ARATH	7E-47	Signal recognition particle 54 kDa protein, chloroplastic (Precursor)
trEMBL	tr\|A0A061ETZ9\|A0A061ETZ9_THECC	4E-48	Chloroplast signal recognition particle 54 kDa subunit {ECO:0000313\|EMBL:EOY08281.1}
TAIR10	AT5G03940.1	2E-40	chloroplast signal recognition particle 54 kDa subunit

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	99662415	99669034	+
GWHAAZE00000003	mRNA	99662415	99669034	+
GWHAAZE00000003	exon	99662415	99662580	+
GWHAAZE00000003	exon	99668754	99668821	+
GWHAAZE00000003	exon	99668909	99669034	+
GWHAAZE00000003	CDS	99662415	99662580	+
GWHAAZE00000003	CDS	99668754	99668821	+
GWHAAZE00000003	CDS	99668909	99669034	+

Transcript Sequence
>GWHTAAZE013274 CTAGTTCTATCTCTCTCAATTGTTTCACAGAGACAGCTATGGGGATTGGTGAATCCCAAGCCAGTAATTGGGTTCAGAAGAGAAATGTCGGGTGTAATTAGAGCTGAAATGTTTGGGCAGCTCACTGGCGGACTTGAATCGGCCTGGAAAAAACTTAAAGGAGAAGTGGTCTTGACAAAGGAAAATATAGTGGAACCTATGAAAGACATTAGGAGAGCTCTTTTAGAAGCAGATGTTAGCCTCCCTGTTGTGCGAAGGTTTGTCCAAACTGTGAGCGAACAAGCTGTTGGTGTTGGCGTGATTAGAGGAGTGAAACCAGATCAGCAATTGGTTAAAGTGCGTATTTTTCTTGACTTATGA

Network for GWHGAAZE013260

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02881.20	SRP54_N	41	112	6.80E-16

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03106	SRP54, ffh	Protein export	map03060
		Bacterial secretion system	map03070
		Quorum sensing	map02024

Gene Ontology

GO term	Ontology	Name
GO:0006614	biological_process	SRP-dependent cotranslational protein targeting to membrane
GO:0005525	molecular_function	GTP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	15.286
	SRR3591706	second leaf	39.296
	SRR3591707	mature leaf	30.351
	SRR3591708	Shoot apex	26.151
	SRR3591709	Stem	13.624
	SRR3591710	White floral bud	11.728
	SRR3591711	White flower	11.082
	SRR3591712	Green floral bud	10.563
	SRR3591713	Yellow flower	14.008
SRP173429	SRR8316895	Juvenile bud stage	12.960
	SRR8316896	Juvenile bud stage	13.007
	SRR8316897	Juvenile bud stage	9.825
	SRR8316894	Third green stage	8.548
	SRR8316900	Third green stage	21.969
	SRR8316901	Third green stage	20.637
	SRR8316898	Complete white stage	4.623
	SRR8316899	Complete white stage	17.864
	SRR8316903	Complete white stage	12.833
	SRR8316902	Silver flowering stage	3.003
	SRR8316904	Silver flowering stage	5.136
	SRR8316905	Silver flowering stage	1.640
	SRR8316906	Gold flowering stage	11.204
	SRR8316907	Gold flowering stage	11.060
	SRR8316908	Gold flowering stage	12.449
SRP132670	SRR6706286	Control	31.823
	SRR6706287	Light intensity 50%	31.078
	SRR6706288	Light intensity 20%	32.923
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.703
	CNS0095593	Slightly white alabastrum(diploid) 2	3.676
	CNS0095594	Slightly white alabastrum(diploid) 3	4.529
	CNS0095595	Whole white alabastrum(diploid) 2	3.200
	CNS0095596	Whole white alabastrum(diploid) 3	3.596
	CNS0095597	Whole white alabastrum(diploid) 4	6.836
	CNS0095598	Silvery flower (diploied) 1	16.186
	CNS0095599	Silvery flower (diploied) 2	9.902
	CNS0095600	Silvery flower (diploied) 3	11.263
	CNS0095601	Golden flower (diploid) 1	12.509
	CNS0095602	Golden flower (diploid) 2	11.325
	CNS0095603	Golden flower (diploid) 3	9.200
	CNS0095604	Slightly white alabastrum(tetraploid) 1	8.496
	CNS0095605	Slightly white alabastrum(tetraploid) 2	4.708
	CNS0095606	Slightly white alabastrum(tetraploid) 3	26.463
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.379
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.361
	CNS0095609	Whole white alabastrum(tetraploid) 3	24.957
	CNS0095610	Silvery flower (tetraploid) 1	15.956
	CNS0095611	Silvery flower (tetraploid) 2	23.940
	CNS0095612	Silvery flower (tetraploid) 3	15.701
	CNS0095613	Golden flower (tetraploid) 1	5.486
	CNS0095614	Golden flower (tetraploid) 2	11.598
	CNS0095615	Golden flower (tetraploid) 3	4.581
CRA001975	CRR073297	Stem 1	20.817
	CRR073298	Stem 2	22.369
	CRR073299	Stem 3	27.343
	CRR073300	Leaf 1	25.286
	CRR073301	Leaf 2	20.303
	CRR073302	Leaf 3	19.540
	CRR073303	Juvenile bud 1	23.171
	CRR073304	Juvenile bud 2	22.154
	CRR073305	Juvenile bud 3	21.122
	CRR073306	Third green 1	4.306
	CRR073307	Third green 2	2.722
	CRR073308	Third green 3	3.213
	CRR073309	Second white 1	7.186
	CRR073310	Second white 2	6.266
	CRR073311	Second white 3	2.736
	CRR073312	Silver flowering 1	3.617
	CRR073313	Silver flowering 2	3.220
	CRR073314	Silver flowering 3	4.380
	CRR073315	Gold flowering 1	25.807
	CRR073316	Gold flowering 2	47.150
	CRR073317	Gold flowering 3	27.935
	CRR073318	Tawny withering 1	7.773
	CRR073319	Tawny withering 2	6.322
	CRR073320	Tawny withering 3	8.699