Gene detail

Detail information of GWHGAAZE013221

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008462494.1	4.41202E-46	PREDICTED: serine/threonine protein phosphatase 2A 57 kDa regulatory subunit B' beta isoform [Cucumis melo]
Swissprot	tr\|O04375\|2A5A_ARATH	1E-31	Serine/threonine protein phosphatase 2A 57 kDa regulatory subunit B' alpha isoform
trEMBL	tr\|A0A0A0KF65\|A0A0A0KF65_CUCSA	5E-46	Uncharacterized protein {ECO:0000313\|EMBL:KGN48198.1}
TAIR10	AT5G03470.1	5E-25	Protein phosphatase 2A regulatory B subunit family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	98957956	98958321	+
GWHAAZE00000003	mRNA	98957956	98958321	+
GWHAAZE00000003	exon	98957956	98958321	+
GWHAAZE00000003	CDS	98957956	98958321	+

Transcript Sequence
>GWHTAAZE013235 ATGTTCACCAAAATTATGAAGAGAGGGCACCGTAAGGTGCCGAAATCAGAGGATTTATACGGCTACGTTCCGCCGGGGCATAGGAACTCCGGTAATGTATCAACTTCAAATGTAGTCATTACCAACGCATCTCGCATTGGTCCCGCTGGGTTGATGCAGCAACAGGCTCCCGGACCGGGGACTTTACTGGCCCCGCCGACTGGTACGATTGAAACCCTACCTATGTTTCGAGATGTTCCTGCTTCCGAGCGGCAGAACTTGTTTCTTCGCAAGGTTCAGGTGTGTTGTTTCCAGTTCGACTTTGTTGACACAATGAGGATGATTAGAGAGAAGGAGATCAAAAGGCAGAGCCTTGTGGAGCTTTGA

Network for GWHGAAZE013221

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01603.21	B56	73	121	9.50E-12

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K11584	PPP2R5	mRNA surveillance pathway	map03015
		Sphingolipid signaling pathway	map04071
		PI3K-Akt signaling pathway	map04151
		AMPK signaling pathway	map04152
		Meiosis - yeast	map04113
		Oocyte meiosis	map04114
		Adrenergic signaling in cardiomyocytes	map04261
		Dopaminergic synapse	map04728

Gene Ontology

GO term	Ontology	Name
GO:0007165	biological_process	signal transduction
GO:0000159	cellular_component	protein phosphatase type 2A complex
GO:0019888	molecular_function	protein phosphatase regulator activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	18.165
	SRR3591706	second leaf	10.819
	SRR3591707	mature leaf	20.811
	SRR3591708	Shoot apex	12.753
	SRR3591709	Stem	17.682
	SRR3591710	White floral bud	36.243
	SRR3591711	White flower	27.555
	SRR3591712	Green floral bud	27.590
	SRR3591713	Yellow flower	31.477
SRP173429	SRR8316895	Juvenile bud stage	6.198
	SRR8316896	Juvenile bud stage	9.408
	SRR8316897	Juvenile bud stage	6.086
	SRR8316894	Third green stage	5.477
	SRR8316900	Third green stage	11.576
	SRR8316901	Third green stage	14.080
	SRR8316898	Complete white stage	4.756
	SRR8316899	Complete white stage	20.771
	SRR8316903	Complete white stage	10.872
	SRR8316902	Silver flowering stage	7.968
	SRR8316904	Silver flowering stage	12.095
	SRR8316905	Silver flowering stage	6.827
	SRR8316906	Gold flowering stage	19.675
	SRR8316907	Gold flowering stage	18.204
	SRR8316908	Gold flowering stage	26.352
SRP132670	SRR6706286	Control	15.785
	SRR6706287	Light intensity 50%	17.708
	SRR6706288	Light intensity 20%	16.508
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.642
	CNS0095593	Slightly white alabastrum(diploid) 2	5.471
	CNS0095594	Slightly white alabastrum(diploid) 3	9.069
	CNS0095595	Whole white alabastrum(diploid) 2	7.324
	CNS0095596	Whole white alabastrum(diploid) 3	4.991
	CNS0095597	Whole white alabastrum(diploid) 4	9.547
	CNS0095598	Silvery flower (diploied) 1	9.908
	CNS0095599	Silvery flower (diploied) 2	7.138
	CNS0095600	Silvery flower (diploied) 3	19.220
	CNS0095601	Golden flower (diploid) 1	4.554
	CNS0095602	Golden flower (diploid) 2	20.244
	CNS0095603	Golden flower (diploid) 3	17.953
	CNS0095604	Slightly white alabastrum(tetraploid) 1	17.573
	CNS0095605	Slightly white alabastrum(tetraploid) 2	15.186
	CNS0095606	Slightly white alabastrum(tetraploid) 3	20.215
	CNS0095607	Whole white alabastrum(tetraploid) 1	20.001
	CNS0095608	Whole white alabastrum(tetraploid) 2	23.851
	CNS0095609	Whole white alabastrum(tetraploid) 3	25.998
	CNS0095610	Silvery flower (tetraploid) 1	29.236
	CNS0095611	Silvery flower (tetraploid) 2	34.230
	CNS0095612	Silvery flower (tetraploid) 3	30.765
	CNS0095613	Golden flower (tetraploid) 1	19.977
	CNS0095614	Golden flower (tetraploid) 2	30.414
	CNS0095615	Golden flower (tetraploid) 3	52.053
CRA001975	CRR073297	Stem 1	16.487
	CRR073298	Stem 2	10.578
	CRR073299	Stem 3	13.510
	CRR073300	Leaf 1	12.366
	CRR073301	Leaf 2	13.531
	CRR073302	Leaf 3	11.294
	CRR073303	Juvenile bud 1	14.620
	CRR073304	Juvenile bud 2	11.738
	CRR073305	Juvenile bud 3	10.618
	CRR073306	Third green 1	14.096
	CRR073307	Third green 2	13.156
	CRR073308	Third green 3	14.917
	CRR073309	Second white 1	9.206
	CRR073310	Second white 2	17.107
	CRR073311	Second white 3	14.551
	CRR073312	Silver flowering 1	11.849
	CRR073313	Silver flowering 2	8.565
	CRR073314	Silver flowering 3	15.629
	CRR073315	Gold flowering 1	7.387
	CRR073316	Gold flowering 2	11.933
	CRR073317	Gold flowering 3	2.943
	CRR073318	Tawny withering 1	11.723
	CRR073319	Tawny withering 2	5.964
	CRR073320	Tawny withering 3	10.359