Gene detail

Detail information of GWHGAAZE013043

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008806967.1	9.1879E-135	PREDICTED: 60S ribosomal protein L10a-2 [Phoenix dactylifera]
Swissprot	tr\|Q8VZB9\|R10A1_ARATH	5E-128	60S ribosomal protein L10a-1
trEMBL	tr\|F6HKK9\|F6HKK9_VITVI	6E-132	Ribosomal protein {ECO:0000256\|RuleBase:RU000659}
TAIR10	AT1G08360.1	1E-100	Ribosomal protein L1p/L10e family

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	95821021	95824267	-
GWHAAZE00000003	mRNA	95821021	95824267	-
GWHAAZE00000003	exon	95821021	95821074	-
GWHAAZE00000003	exon	95821638	95821843	-
GWHAAZE00000003	exon	95822445	95822610	-
GWHAAZE00000003	exon	95823215	95823437	-
GWHAAZE00000003	exon	95824263	95824267	-
GWHAAZE00000003	CDS	95824263	95824267	-
GWHAAZE00000003	CDS	95823215	95823437	-
GWHAAZE00000003	CDS	95822445	95822610	-
GWHAAZE00000003	CDS	95821638	95821843	-
GWHAAZE00000003	CDS	95821021	95821074	-

Transcript Sequence
>GWHTAAZE013057 ATGAGTAAGCTTCAGAGTGATGCCTTGAGAGAAGCTATTACACAGATTGCCAAGGATGCAGCAGGGGAGAAAAAGCGCAATTTTGTCGAGACCATTGAGCTTCAGATTGGTCTGAAGAACTATGATCCCCAGAAGGATAAGCGTTTCAGTGGTTCTGTGAAATTGCCTCACATCCCTCGTCCTAAGATGAAGGTTTGCATGCTTGGAGATGCTCAGCATGTGGAAGAGGCAGAAAAGATAGGTCTAGAATACATGGATGTGGAAGGGTTGAAGAAGCTCAACAAGAACAAGAAGTTGGTGAAGAAACTTGCAAAGAAATACCATGCTTTCTTGGCCTCCGAGGCAGTCATCAAGCAGATTCCCCGTCTTCTCGGCCCTGGTCTCAACAAGGCTGGTAAATTTCCTACACTAGTTACTCACCAGGAATCCCTCGAGTCTAAAGTGAATGAGATAAAGGCCACTGTAAAGTTTCAATTGAAGAAGGTGCTGTGCATGGGAGTTGCTGTTGGGAACTGCAGTATGGAAGAGAAACAGATATTCCAAAACGTGCAGATGAGCGTCAACTTCCTTGTTTCTCTTTTGAAGAAGAATTGGCAAAATGTGAGGTGCTTGTACCTGAAGAGCACGATGGGGAAGCCAGTGCGCATCTTTTAA

Network for GWHGAAZE013043

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00687.22	Ribosomal_L1	24	211	1.50E-45

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02865	RP-L10Ae, RPL10A	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0015934	cellular_component	large ribosomal subunit
GO:0003723	molecular_function	RNA binding
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	430.258
	SRR3591706	second leaf	150.265
	SRR3591707	mature leaf	82.970
	SRR3591708	Shoot apex	452.111
	SRR3591709	Stem	201.454
	SRR3591710	White floral bud	160.050
	SRR3591711	White flower	203.215
	SRR3591712	Green floral bud	306.139
	SRR3591713	Yellow flower	187.694
SRP173429	SRR8316895	Juvenile bud stage	175.047
	SRR8316896	Juvenile bud stage	251.366
	SRR8316897	Juvenile bud stage	133.156
	SRR8316894	Third green stage	116.727
	SRR8316900	Third green stage	375.947
	SRR8316901	Third green stage	356.527
	SRR8316898	Complete white stage	80.685
	SRR8316899	Complete white stage	317.410
	SRR8316903	Complete white stage	112.684
	SRR8316902	Silver flowering stage	77.193
	SRR8316904	Silver flowering stage	89.282
	SRR8316905	Silver flowering stage	40.084
	SRR8316906	Gold flowering stage	152.015
	SRR8316907	Gold flowering stage	154.393
	SRR8316908	Gold flowering stage	203.857
SRP132670	SRR6706286	Control	395.334
	SRR6706287	Light intensity 50%	402.336
	SRR6706288	Light intensity 20%	457.337
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	280.613
	CNS0095593	Slightly white alabastrum(diploid) 2	327.434
	CNS0095594	Slightly white alabastrum(diploid) 3	272.179
	CNS0095595	Whole white alabastrum(diploid) 2	252.695
	CNS0095596	Whole white alabastrum(diploid) 3	297.761
	CNS0095597	Whole white alabastrum(diploid) 4	197.109
	CNS0095598	Silvery flower (diploied) 1	158.252
	CNS0095599	Silvery flower (diploied) 2	158.888
	CNS0095600	Silvery flower (diploied) 3	129.254
	CNS0095601	Golden flower (diploid) 1	121.017
	CNS0095602	Golden flower (diploid) 2	121.618
	CNS0095603	Golden flower (diploid) 3	113.321
	CNS0095604	Slightly white alabastrum(tetraploid) 1	278.323
	CNS0095605	Slightly white alabastrum(tetraploid) 2	259.283
	CNS0095606	Slightly white alabastrum(tetraploid) 3	316.488
	CNS0095607	Whole white alabastrum(tetraploid) 1	152.225
	CNS0095608	Whole white alabastrum(tetraploid) 2	149.733
	CNS0095609	Whole white alabastrum(tetraploid) 3	287.369
	CNS0095610	Silvery flower (tetraploid) 1	147.245
	CNS0095611	Silvery flower (tetraploid) 2	114.100
	CNS0095612	Silvery flower (tetraploid) 3	92.683
	CNS0095613	Golden flower (tetraploid) 1	81.998
	CNS0095614	Golden flower (tetraploid) 2	99.012
	CNS0095615	Golden flower (tetraploid) 3	62.367
CRA001975	CRR073297	Stem 1	332.372
	CRR073298	Stem 2	340.588
	CRR073299	Stem 3	379.115
	CRR073300	Leaf 1	363.825
	CRR073301	Leaf 2	379.937
	CRR073302	Leaf 3	496.553
	CRR073303	Juvenile bud 1	413.605
	CRR073304	Juvenile bud 2	323.072
	CRR073305	Juvenile bud 3	287.917
	CRR073306	Third green 1	70.650
	CRR073307	Third green 2	70.893
	CRR073308	Third green 3	68.629
	CRR073309	Second white 1	73.463
	CRR073310	Second white 2	61.849
	CRR073311	Second white 3	49.065
	CRR073312	Silver flowering 1	69.802
	CRR073313	Silver flowering 2	78.496
	CRR073314	Silver flowering 3	65.419
	CRR073315	Gold flowering 1	138.185
	CRR073316	Gold flowering 2	164.960
	CRR073317	Gold flowering 3	122.357
	CRR073318	Tawny withering 1	289.877
	CRR073319	Tawny withering 2	268.897
	CRR073320	Tawny withering 3	308.280