Gene detail

Detail information of GWHGAAZE013020

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP12664.1	1.32105E-87	unnamed protein product [Coffea canephora]
Swissprot	tr\|O04348\|TPP1_ARATH	2E-10	Thylakoidal processing peptidase 1, chloroplastic (Precursor)
trEMBL	tr\|A0A068UWN2\|A0A068UWN2_COFCA	5E-88	Coffea canephora DH200=94 genomic scaffold, scaffold_69 {ECO:0000313\|EMBL:CDP12664.1}
TAIR10	AT3G08980.1	3E-52	Peptidase S24/S26A/S26B/S26C family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	95437231	95439530	+
GWHAAZE00000003	mRNA	95437231	95439530	+
GWHAAZE00000003	exon	95437231	95437396	+
GWHAAZE00000003	exon	95437481	95437553	+
GWHAAZE00000003	exon	95438193	95438358	+
GWHAAZE00000003	exon	95439426	95439530	+
GWHAAZE00000003	CDS	95437231	95437396	+
GWHAAZE00000003	CDS	95437481	95437553	+
GWHAAZE00000003	CDS	95438193	95438358	+
GWHAAZE00000003	CDS	95439426	95439530	+

Transcript Sequence
>GWHTAAZE013034 ATGGGTTTTCGAAGTCTTGTGTGGAAGACCGCCAAGAATTATTTAACGTTTGGGCTCATAGGCATTACTGTATCAGATCGTTATGCCAGTATCGTCCCTGTTCTTGGCCACTCTATGTCTCCCACATTCAATCCCCATAGCAGCACTTCAATGGGGTCATTAACTGATGACTATGTTTTGGTAGAAAAATTTTGCCTTGAAAAGTACAAGTTCTCACAAGGTGACGTGGTAATTTTCTGCTCTCCAAGCGATCACAAGAGGAGAAACATAAAAAGGATAACTGGGTTGCCTGGTGACTGGATCAGAACTCCTTCCACCTATGATGCTTCGAAAATTCCAGAAGGCCATTGTTGGGTTGAGGGAGACAACTCAGCTTCTAGCTTTGATTCAAGATCCTATGGCCCGATACCATTGGGTCTAATACAGGGAAGGGCTACCCACATTATTTGGCCGCCTCAAAGAATAGGCAAAGTTGATAGGAGAATTCCCCAGGGCGGACTCGCCTTCTAA

Network for GWHGAAZE013020

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF10502.10	Peptidase_S26	10	103	7.70E-12
PF10502.10	Peptidase_S26	108	150	1.10E-08

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K09648	IMP2	Protein export	map03060

Gene Ontology

GO term	Ontology	Name
GO:0006508	biological_process	proteolysis
GO:0016020	cellular_component	membrane
GO:0008236	molecular_function	serine-type peptidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	11.306
	SRR3591706	second leaf	6.696
	SRR3591707	mature leaf	8.227
	SRR3591708	Shoot apex	13.568
	SRR3591709	Stem	16.718
	SRR3591710	White floral bud	12.737
	SRR3591711	White flower	15.455
	SRR3591712	Green floral bud	15.856
	SRR3591713	Yellow flower	15.664
SRP173429	SRR8316895	Juvenile bud stage	9.734
	SRR8316896	Juvenile bud stage	15.462
	SRR8316897	Juvenile bud stage	6.922
	SRR8316894	Third green stage	6.453
	SRR8316900	Third green stage	18.396
	SRR8316901	Third green stage	18.700
	SRR8316898	Complete white stage	6.890
	SRR8316899	Complete white stage	21.731
	SRR8316903	Complete white stage	9.519
	SRR8316902	Silver flowering stage	8.280
	SRR8316904	Silver flowering stage	8.734
	SRR8316905	Silver flowering stage	4.030
	SRR8316906	Gold flowering stage	14.393
	SRR8316907	Gold flowering stage	18.637
	SRR8316908	Gold flowering stage	17.330
SRP132670	SRR6706286	Control	10.340
	SRR6706287	Light intensity 50%	11.298
	SRR6706288	Light intensity 20%	12.025
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	20.937
	CNS0095593	Slightly white alabastrum(diploid) 2	22.706
	CNS0095594	Slightly white alabastrum(diploid) 3	29.284
	CNS0095595	Whole white alabastrum(diploid) 2	23.368
	CNS0095596	Whole white alabastrum(diploid) 3	27.207
	CNS0095597	Whole white alabastrum(diploid) 4	20.566
	CNS0095598	Silvery flower (diploied) 1	16.756
	CNS0095599	Silvery flower (diploied) 2	18.647
	CNS0095600	Silvery flower (diploied) 3	24.152
	CNS0095601	Golden flower (diploid) 1	16.181
	CNS0095602	Golden flower (diploid) 2	19.895
	CNS0095603	Golden flower (diploid) 3	19.773
	CNS0095604	Slightly white alabastrum(tetraploid) 1	20.036
	CNS0095605	Slightly white alabastrum(tetraploid) 2	20.986
	CNS0095606	Slightly white alabastrum(tetraploid) 3	13.715
	CNS0095607	Whole white alabastrum(tetraploid) 1	25.632
	CNS0095608	Whole white alabastrum(tetraploid) 2	23.042
	CNS0095609	Whole white alabastrum(tetraploid) 3	14.839
	CNS0095610	Silvery flower (tetraploid) 1	16.096
	CNS0095611	Silvery flower (tetraploid) 2	18.435
	CNS0095612	Silvery flower (tetraploid) 3	13.653
	CNS0095613	Golden flower (tetraploid) 1	17.943
	CNS0095614	Golden flower (tetraploid) 2	18.287
	CNS0095615	Golden flower (tetraploid) 3	21.739
CRA001975	CRR073297	Stem 1	11.607
	CRR073298	Stem 2	8.955
	CRR073299	Stem 3	7.931
	CRR073300	Leaf 1	11.410
	CRR073301	Leaf 2	9.020
	CRR073302	Leaf 3	9.458
	CRR073303	Juvenile bud 1	15.160
	CRR073304	Juvenile bud 2	7.726
	CRR073305	Juvenile bud 3	11.718
	CRR073306	Third green 1	6.831
	CRR073307	Third green 2	6.953
	CRR073308	Third green 3	5.197
	CRR073309	Second white 1	5.967
	CRR073310	Second white 2	9.690
	CRR073311	Second white 3	7.708
	CRR073312	Silver flowering 1	7.186
	CRR073313	Silver flowering 2	6.811
	CRR073314	Silver flowering 3	2.084
	CRR073315	Gold flowering 1	4.716
	CRR073316	Gold flowering 2	4.080
	CRR073317	Gold flowering 3	2.350
	CRR073318	Tawny withering 1	9.525
	CRR073319	Tawny withering 2	8.648
	CRR073320	Tawny withering 3	10.947