Gene detail

Detail information of GWHGAAZE012935

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010252021.1	7.1172E-51	PREDICTED: thioredoxin H4-1 [Nelumbo nucifera]
Swissprot	tr\|P85801\|TRXH_POPJC	4E-49	Thioredoxin H-type
trEMBL	tr\|A0A022RT03\|A0A022RT03_ERYGU	4E-51	Thioredoxin {ECO:0000256\|PIRNR:PIRNR000077}
TAIR10	AT3G08710.2	1E-36	thioredoxin H-type 9

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	94001579	94002166	+
GWHAAZE00000003	mRNA	94001579	94002166	+
GWHAAZE00000003	exon	94001579	94001701	+
GWHAAZE00000003	exon	94002014	94002166	+
GWHAAZE00000003	CDS	94001579	94001701	+
GWHAAZE00000003	CDS	94002014	94002166	+

Transcript Sequence
>GWHTAAZE012949 GTGGTTGCAAATTTCAGTGCGTCGTGGTGTGGTCCTTGTAGAATGATTGCGCCATTATACTCCGAGCTATCTGAGAAATACCCATCTCTAATGTTTTTAACAGTTGATGTTGATGAGCTGACTGAATTCAGTACAACATGGGATATAAAAGCTACACCAACCTTCTTCTTCCTGAGAGATGGACAGCAAATCGACAAACTCGTAGGGGCCAACAAGCCAGAGCTTCAGAAGAAGATAACTGCCATTGCCGATTCTCTCTCCCCTGTTCCCAAATAA

Network for GWHGAAZE012935

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00085.21	Thioredoxin	1	80	1.90E-22

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03671	trxA	NOD-like receptor signaling pathway	map04621

Gene Ontology

GO term	Ontology	Name
GO:0045454	biological_process	cell redox homeostasis
GO:0006662	biological_process	glycerol ether metabolic process
GO:0015035	molecular_function	protein disulfide oxidoreductase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	116.678
	SRR3591706	second leaf	41.049
	SRR3591707	mature leaf	48.368
	SRR3591708	Shoot apex	95.697
	SRR3591709	Stem	124.760
	SRR3591710	White floral bud	75.352
	SRR3591711	White flower	74.493
	SRR3591712	Green floral bud	92.665
	SRR3591713	Yellow flower	59.983
SRP173429	SRR8316895	Juvenile bud stage	48.872
	SRR8316896	Juvenile bud stage	64.006
	SRR8316897	Juvenile bud stage	36.852
	SRR8316894	Third green stage	21.802
	SRR8316900	Third green stage	85.376
	SRR8316901	Third green stage	83.029
	SRR8316898	Complete white stage	31.345
	SRR8316899	Complete white stage	118.320
	SRR8316903	Complete white stage	42.863
	SRR8316902	Silver flowering stage	36.625
	SRR8316904	Silver flowering stage	33.647
	SRR8316905	Silver flowering stage	20.389
	SRR8316906	Gold flowering stage	61.459
	SRR8316907	Gold flowering stage	62.539
	SRR8316908	Gold flowering stage	62.402
SRP132670	SRR6706286	Control	59.656
	SRR6706287	Light intensity 50%	64.281
	SRR6706288	Light intensity 20%	74.991
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	95.668
	CNS0095593	Slightly white alabastrum(diploid) 2	106.786
	CNS0095594	Slightly white alabastrum(diploid) 3	91.074
	CNS0095595	Whole white alabastrum(diploid) 2	81.328
	CNS0095596	Whole white alabastrum(diploid) 3	90.646
	CNS0095597	Whole white alabastrum(diploid) 4	85.290
	CNS0095598	Silvery flower (diploied) 1	82.521
	CNS0095599	Silvery flower (diploied) 2	89.601
	CNS0095600	Silvery flower (diploied) 3	77.713
	CNS0095601	Golden flower (diploid) 1	92.788
	CNS0095602	Golden flower (diploid) 2	80.110
	CNS0095603	Golden flower (diploid) 3	66.644
	CNS0095604	Slightly white alabastrum(tetraploid) 1	85.879
	CNS0095605	Slightly white alabastrum(tetraploid) 2	76.656
	CNS0095606	Slightly white alabastrum(tetraploid) 3	103.100
	CNS0095607	Whole white alabastrum(tetraploid) 1	72.998
	CNS0095608	Whole white alabastrum(tetraploid) 2	73.376
	CNS0095609	Whole white alabastrum(tetraploid) 3	72.001
	CNS0095610	Silvery flower (tetraploid) 1	66.881
	CNS0095611	Silvery flower (tetraploid) 2	71.537
	CNS0095612	Silvery flower (tetraploid) 3	63.861
	CNS0095613	Golden flower (tetraploid) 1	59.704
	CNS0095614	Golden flower (tetraploid) 2	61.683
	CNS0095615	Golden flower (tetraploid) 3	50.409
CRA001975	CRR073297	Stem 1	85.985
	CRR073298	Stem 2	68.628
	CRR073299	Stem 3	82.167
	CRR073300	Leaf 1	63.428
	CRR073301	Leaf 2	64.889
	CRR073302	Leaf 3	67.401
	CRR073303	Juvenile bud 1	103.110
	CRR073304	Juvenile bud 2	71.650
	CRR073305	Juvenile bud 3	84.813
	CRR073306	Third green 1	40.896
	CRR073307	Third green 2	57.884
	CRR073308	Third green 3	35.560
	CRR073309	Second white 1	52.482
	CRR073310	Second white 2	46.282
	CRR073311	Second white 3	40.349
	CRR073312	Silver flowering 1	55.458
	CRR073313	Silver flowering 2	58.544
	CRR073314	Silver flowering 3	40.192
	CRR073315	Gold flowering 1	59.037
	CRR073316	Gold flowering 2	65.234
	CRR073317	Gold flowering 3	58.989
	CRR073318	Tawny withering 1	94.249
	CRR073319	Tawny withering 2	95.518
	CRR073320	Tawny withering 3	99.599