Gene detail

Detail information of GWHGAAZE012852

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009796939.1	1.8704E-87	PREDICTED: transcription factor DIVARICATA-like [Nicotiana sylvestris]
Swissprot	tr\|Q8S9H7\|DIV_ANTMA	3E-48	Transcription factor DIVARICATA
trEMBL	tr\|A0A068TV40\|A0A068TV40_COFCA	3E-87	Coffea canephora DH200=94 genomic scaffold, scaffold_4 {ECO:0000313\|EMBL:CDO99922.1}
TAIR10	AT5G04760.1	2E-52	Duplicated homeodomain-like superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	92530234	92532623	+
GWHAAZE00000003	mRNA	92530234	92532623	+
GWHAAZE00000003	exon	92530234	92530514	+
GWHAAZE00000003	exon	92532359	92532623	+
GWHAAZE00000003	CDS	92530234	92530514	+
GWHAAZE00000003	CDS	92532359	92532623	+

Transcript Sequence
>GWHTAAZE012866 ATGTTCCCAGAAGGAATCTCCGATCGGTGGCAAAAAATTGCCGGTAGGGTACCCGGAAAGTCGGCTGATGATGTAAAAGCTCATTACGATACTTTGGTACATGATGTTTTCGAGATAGATTCGGGGCGAGTTGAGTTGCCCAGTTACTCTGACGATGACTCGTTCGGATGGGAATCGACCGAGTTGAGTGCCAGTCAAATCTCTTTTGGCTCAGCGAAAGGGAATAAGCATGGAGGAGAGGAGAGAAAGAAAGGGACTCCTTGGACTGAAGAAGAACACAAATTATTTCTAATCGGACTGGATAGATACGGCAAAGGCGATTGGCGGAGCATTTCAAGAAACGTGGTGGTGACAAGAACGCCAACTCAAGTGGCTAGCCATGCCCAAAAGTACTATCTCCGCCAGAACTCAATGAAGAAAGAGCGAAAGAGGTCAAGCATTCATGATATCACCACCACTGTTGATACCAAGCCAGTGGTTCCACCGACCAACTTCTCTAACCAGGGAGGGTCGATGGGATACCAAAACTTCGGGTATCCGATGTGA

Network for GWHGAAZE012852

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00249.32	Myb_DNA-binding	87	131	9.30E-12

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	MYB-related

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	145.423
	SRR3591706	second leaf	3.042
	SRR3591707	mature leaf	4.877
	SRR3591708	Shoot apex	15.683
	SRR3591709	Stem	92.642
	SRR3591710	White floral bud	31.299
	SRR3591711	White flower	40.236
	SRR3591712	Green floral bud	11.780
	SRR3591713	Yellow flower	48.225
SRP173429	SRR8316895	Juvenile bud stage	26.830
	SRR8316896	Juvenile bud stage	31.171
	SRR8316897	Juvenile bud stage	44.999
	SRR8316894	Third green stage	7.515
	SRR8316900	Third green stage	20.887
	SRR8316901	Third green stage	39.702
	SRR8316898	Complete white stage	13.815
	SRR8316899	Complete white stage	85.787
	SRR8316903	Complete white stage	23.429
	SRR8316902	Silver flowering stage	18.214
	SRR8316904	Silver flowering stage	16.145
	SRR8316905	Silver flowering stage	12.489
	SRR8316906	Gold flowering stage	35.802
	SRR8316907	Gold flowering stage	46.036
	SRR8316908	Gold flowering stage	33.614
SRP132670	SRR6706286	Control	27.710
	SRR6706287	Light intensity 50%	28.505
	SRR6706288	Light intensity 20%	20.960
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	20.594
	CNS0095593	Slightly white alabastrum(diploid) 2	33.770
	CNS0095594	Slightly white alabastrum(diploid) 3	28.105
	CNS0095595	Whole white alabastrum(diploid) 2	19.418
	CNS0095596	Whole white alabastrum(diploid) 3	7.649
	CNS0095597	Whole white alabastrum(diploid) 4	15.196
	CNS0095598	Silvery flower (diploied) 1	49.881
	CNS0095599	Silvery flower (diploied) 2	72.512
	CNS0095600	Silvery flower (diploied) 3	79.660
	CNS0095601	Golden flower (diploid) 1	65.201
	CNS0095602	Golden flower (diploid) 2	88.934
	CNS0095603	Golden flower (diploid) 3	87.465
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.257
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.020
	CNS0095606	Slightly white alabastrum(tetraploid) 3	5.172
	CNS0095607	Whole white alabastrum(tetraploid) 1	5.878
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.254
	CNS0095609	Whole white alabastrum(tetraploid) 3	3.752
	CNS0095610	Silvery flower (tetraploid) 1	29.420
	CNS0095611	Silvery flower (tetraploid) 2	22.377
	CNS0095612	Silvery flower (tetraploid) 3	19.429
	CNS0095613	Golden flower (tetraploid) 1	22.541
	CNS0095614	Golden flower (tetraploid) 2	24.353
	CNS0095615	Golden flower (tetraploid) 3	24.842
CRA001975	CRR073297	Stem 1	22.706
	CRR073298	Stem 2	23.042
	CRR073299	Stem 3	18.325
	CRR073300	Leaf 1	51.230
	CRR073301	Leaf 2	66.866
	CRR073302	Leaf 3	43.496
	CRR073303	Juvenile bud 1	53.418
	CRR073304	Juvenile bud 2	55.298
	CRR073305	Juvenile bud 3	62.718
	CRR073306	Third green 1	14.015
	CRR073307	Third green 2	27.626
	CRR073308	Third green 3	15.736
	CRR073309	Second white 1	8.250
	CRR073310	Second white 2	15.870
	CRR073311	Second white 3	9.652
	CRR073312	Silver flowering 1	33.672
	CRR073313	Silver flowering 2	29.895
	CRR073314	Silver flowering 3	24.989
	CRR073315	Gold flowering 1	60.799
	CRR073316	Gold flowering 2	89.423
	CRR073317	Gold flowering 3	39.193
	CRR073318	Tawny withering 1	63.039
	CRR073319	Tawny withering 2	208.880
	CRR073320	Tawny withering 3	80.775