Gene detail

Detail information of GWHGAAZE012827

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010067109.1	1.22172E-81	PREDICTED: 7-methylguanosine phosphate-specific 5'-nucleotidase A [Eucalyptus grandis]
trEMBL	tr\|A0A059BGD4\|A0A059BGD4_EUCGR	5E-82	Uncharacterized protein {ECO:0000313\|EMBL:KCW65178.1}
TAIR10	AT2G38680.1	2E-45	5'-nucleotidases;magnesium ion binding

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	92260926	92263640	+
GWHAAZE00000003	mRNA	92260926	92263640	+
GWHAAZE00000003	exon	92260926	92261078	+
GWHAAZE00000003	exon	92261992	92262052	+
GWHAAZE00000003	exon	92262145	92262277	+
GWHAAZE00000003	exon	92263000	92263123	+
GWHAAZE00000003	exon	92263441	92263495	+
GWHAAZE00000003	exon	92263618	92263640	+
GWHAAZE00000003	CDS	92260926	92261078	+
GWHAAZE00000003	CDS	92261992	92262052	+
GWHAAZE00000003	CDS	92262145	92262277	+
GWHAAZE00000003	CDS	92263000	92263123	+
GWHAAZE00000003	CDS	92263441	92263495	+
GWHAAZE00000003	CDS	92263618	92263640	+

Transcript Sequence
>GWHTAAZE012841 GTTTGGTGTGGAAGTAATTGGAGCAGGAATCAAACTGAAATGGAACAAGTTGATGGTGCCACTAGATGTTTTTCAGAGGTTGTAGTGGGGGATTCCGATTCTCTTGAGAAGAAAACAGCTGCTATCCGGCTTGCGGGTCCCTCAAAACTTCAGGTAATTGCAGATTTTGATGCCACACTGACAAGATATTGGATTGATGGCCGTCGAGGCCAAAGTAGTCATGGCCTTTTGCAGCAGGCGAATCCTGAGTACAATGTCAAGAGACAGAAATTATTCGAATATTATCATCCGCTAGAGTTTAACCCAACAATTCCCCGCGACGAGAAAACAAAGCTTATGGAGGAGTGGTGGGAGAAAACCCATGGCCTTCTTATAGAGGGAGGCCTTACATATGATGCAATAAAGAACTCTGTAGCTAGTGCCATGATTGCATTTAGGGAGGGTGTAGTTGAGCTGTTTGAGTTTCTTGAGGAGAGAGATGTTCCCATTCTTATATTTTCTGCTGGACTCAGATATAATAGAGGAGGTCCTCCGTCAGAAACTTCATAG

Network for GWHGAAZE012827

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF05822.13	UMPH-1	58	170	1.30E-39

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01081	E3.1.3.5	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Purine metabolism	map00230
		Pyrimidine metabolism	map00240
		Nicotinate and nicotinamide metabolism	map00760

Gene Ontology

GO term	Ontology	Name
GO:0005737	cellular_component	cytoplasm
GO:0000287	molecular_function	magnesium ion binding
GO:0008253	molecular_function	5'-nucleotidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	12.342
	SRR3591706	second leaf	5.395
	SRR3591707	mature leaf	2.558
	SRR3591708	Shoot apex	13.963
	SRR3591709	Stem	8.412
	SRR3591710	White floral bud	23.716
	SRR3591711	White flower	17.713
	SRR3591712	Green floral bud	27.619
	SRR3591713	Yellow flower	6.407
SRP173429	SRR8316895	Juvenile bud stage	5.628
	SRR8316896	Juvenile bud stage	7.141
	SRR8316897	Juvenile bud stage	5.121
	SRR8316894	Third green stage	4.710
	SRR8316900	Third green stage	12.032
	SRR8316901	Third green stage	12.426
	SRR8316898	Complete white stage	9.952
	SRR8316899	Complete white stage	19.926
	SRR8316903	Complete white stage	10.485
	SRR8316902	Silver flowering stage	2.420
	SRR8316904	Silver flowering stage	2.821
	SRR8316905	Silver flowering stage	1.460
	SRR8316906	Gold flowering stage	5.152
	SRR8316907	Gold flowering stage	4.844
	SRR8316908	Gold flowering stage	2.250
SRP132670	SRR6706286	Control	24.342
	SRR6706287	Light intensity 50%	24.631
	SRR6706288	Light intensity 20%	25.946
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	6.363
	CNS0095593	Slightly white alabastrum(diploid) 2	8.484
	CNS0095594	Slightly white alabastrum(diploid) 3	4.473
	CNS0095595	Whole white alabastrum(diploid) 2	7.007
	CNS0095596	Whole white alabastrum(diploid) 3	4.640
	CNS0095597	Whole white alabastrum(diploid) 4	5.504
	CNS0095598	Silvery flower (diploied) 1	5.839
	CNS0095599	Silvery flower (diploied) 2	7.602
	CNS0095600	Silvery flower (diploied) 3	10.885
	CNS0095601	Golden flower (diploid) 1	2.510
	CNS0095602	Golden flower (diploid) 2	4.696
	CNS0095603	Golden flower (diploid) 3	4.557
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.743
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.334
	CNS0095606	Slightly white alabastrum(tetraploid) 3	4.856
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.302
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.936
	CNS0095609	Whole white alabastrum(tetraploid) 3	4.975
	CNS0095610	Silvery flower (tetraploid) 1	3.650
	CNS0095611	Silvery flower (tetraploid) 2	3.139
	CNS0095612	Silvery flower (tetraploid) 3	8.228
	CNS0095613	Golden flower (tetraploid) 1	0.311
	CNS0095614	Golden flower (tetraploid) 2	0.743
	CNS0095615	Golden flower (tetraploid) 3	0.640
CRA001975	CRR073297	Stem 1	12.525
	CRR073298	Stem 2	11.401
	CRR073299	Stem 3	12.678
	CRR073300	Leaf 1	17.069
	CRR073301	Leaf 2	19.681
	CRR073302	Leaf 3	14.841
	CRR073303	Juvenile bud 1	14.535
	CRR073304	Juvenile bud 2	18.340
	CRR073305	Juvenile bud 3	10.242
	CRR073306	Third green 1	5.655
	CRR073307	Third green 2	7.361
	CRR073308	Third green 3	11.253
	CRR073309	Second white 1	3.326
	CRR073310	Second white 2	3.213
	CRR073311	Second white 3	1.169
	CRR073312	Silver flowering 1	1.040
	CRR073313	Silver flowering 2	0.711
	CRR073314	Silver flowering 3	1.032
	CRR073315	Gold flowering 1	5.689
	CRR073316	Gold flowering 2	7.155
	CRR073317	Gold flowering 3	5.682
	CRR073318	Tawny withering 1	4.208
	CRR073319	Tawny withering 2	5.052
	CRR073320	Tawny withering 3	6.134