Gene detail

Detail information of GWHGAAZE012402

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002523768.1	1.1887E-145	ATP-dependent Clp protease proteolytic subunit, putative [Ricinus communis]
Swissprot	tr\|Q9FN42\|CLPP2_ARATH	1E-141	ATP-dependent Clp protease proteolytic subunit 2, mitochondrial (Precursor)
trEMBL	tr\|B9SCP9\|B9SCP9_RICCO	4E-146	ATP-dependent Clp protease proteolytic subunit {ECO:0000256\|RuleBase:RU003567}
TAIR10	AT5G23140.1	9E-106	nuclear-encoded CLP protease P7

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	84925173	84927104	+
GWHAAZE00000003	mRNA	84925173	84927104	+
GWHAAZE00000003	exon	84925173	84925452	+
GWHAAZE00000003	exon	84926692	84927104	+
GWHAAZE00000003	CDS	84925173	84925452	+
GWHAAZE00000003	CDS	84926692	84927104	+

Transcript Sequence
>GWHTAAZE012416 GCGACCAATCTATGGAGCAAAATCACCGACCCATTGCCATCAGTTACCACTTCGAGATCCTACAGTGTTATACCCATGGTGATCGAGCATTCGTCGAGAGGAGAGAGGGCTTACGACATCTTCTCTCGCCTCCTTAAAGAGCGAATCATTTGCATCAACGGTCCTATCTCCGACGATACTGCCCACGTCGTTGTTGCTCAGCTCCTCTTCCTCGAATCCGAAAACCCTTCCAAGCCCATCCACATGTATCTCAACTCCCCCGGCGGAGCCGTCACTGCAGGTCTTGCAATATATGATACAATGCAGTACATTCGATCTCCAATCAATACTATATGTTTGGGCCAGGCTGCATCAATGGCTTCGCTCCTCTTGGCTTCTGGCACAAAGGGTGAGAGGCGCTCTCTCCCTAATGCTACTGTCATGATTCATCAACCTTCCGGTGGGTACAGTGGGCAGGCTAAAGATATTACCATTCACACGAAGCAGATTGTTCGAGTTTGGGATTCACTAAATGAATTGTACAAGAAGCATACAGGACAGCCAATAGAGACTATCCAGAAAAACATGGATCGGGATTATTTTATGACCCCAGAAGAGGCAAAAGAGTTTGGAATAATTGACGAGGTTATAGATCATAGACCAATGACTCTAGTGACTGATGCTGTTGGGGATGAAGGAAAAGATAAAGCTTAA

Network for GWHGAAZE012402

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00574.24	CLP_protease	33	212	1.80E-81

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01358	clpP, CLPP	Cell cycle - Caulobacter	map04112
K01358	clpP, CLPP	Longevity regulating pathway - worm	map04212

Gene Ontology

GO term	Ontology	Name
GO:0006508	biological_process	proteolysis
GO:0004252	molecular_function	serine-type endopeptidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	21.610
	SRR3591706	second leaf	13.865
	SRR3591707	mature leaf	11.632
	SRR3591708	Shoot apex	25.349
	SRR3591709	Stem	13.871
	SRR3591710	White floral bud	16.545
	SRR3591711	White flower	24.684
	SRR3591712	Green floral bud	23.601
	SRR3591713	Yellow flower	26.844
SRP173429	SRR8316895	Juvenile bud stage	18.746
	SRR8316896	Juvenile bud stage	29.938
	SRR8316897	Juvenile bud stage	17.248
	SRR8316894	Third green stage	8.931
	SRR8316900	Third green stage	25.148
	SRR8316901	Third green stage	24.717
	SRR8316898	Complete white stage	5.723
	SRR8316899	Complete white stage	25.491
	SRR8316903	Complete white stage	13.256
	SRR8316902	Silver flowering stage	9.399
	SRR8316904	Silver flowering stage	13.291
	SRR8316905	Silver flowering stage	4.967
	SRR8316906	Gold flowering stage	19.589
	SRR8316907	Gold flowering stage	22.889
	SRR8316908	Gold flowering stage	24.899
SRP132670	SRR6706286	Control	33.029
	SRR6706287	Light intensity 50%	34.001
	SRR6706288	Light intensity 20%	34.836
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	25.331
	CNS0095593	Slightly white alabastrum(diploid) 2	21.256
	CNS0095594	Slightly white alabastrum(diploid) 3	25.612
	CNS0095595	Whole white alabastrum(diploid) 2	17.081
	CNS0095596	Whole white alabastrum(diploid) 3	17.572
	CNS0095597	Whole white alabastrum(diploid) 4	17.808
	CNS0095598	Silvery flower (diploied) 1	13.331
	CNS0095599	Silvery flower (diploied) 2	19.210
	CNS0095600	Silvery flower (diploied) 3	20.836
	CNS0095601	Golden flower (diploid) 1	14.523
	CNS0095602	Golden flower (diploid) 2	21.449
	CNS0095603	Golden flower (diploid) 3	19.722
	CNS0095604	Slightly white alabastrum(tetraploid) 1	20.453
	CNS0095605	Slightly white alabastrum(tetraploid) 2	21.570
	CNS0095606	Slightly white alabastrum(tetraploid) 3	23.274
	CNS0095607	Whole white alabastrum(tetraploid) 1	13.932
	CNS0095608	Whole white alabastrum(tetraploid) 2	12.437
	CNS0095609	Whole white alabastrum(tetraploid) 3	20.045
	CNS0095610	Silvery flower (tetraploid) 1	21.674
	CNS0095611	Silvery flower (tetraploid) 2	18.068
	CNS0095612	Silvery flower (tetraploid) 3	16.526
	CNS0095613	Golden flower (tetraploid) 1	17.824
	CNS0095614	Golden flower (tetraploid) 2	21.714
	CNS0095615	Golden flower (tetraploid) 3	20.411
CRA001975	CRR073297	Stem 1	25.095
	CRR073298	Stem 2	23.671
	CRR073299	Stem 3	27.076
	CRR073300	Leaf 1	20.982
	CRR073301	Leaf 2	21.818
	CRR073302	Leaf 3	22.426
	CRR073303	Juvenile bud 1	19.662
	CRR073304	Juvenile bud 2	25.160
	CRR073305	Juvenile bud 3	26.464
	CRR073306	Third green 1	7.689
	CRR073307	Third green 2	9.153
	CRR073308	Third green 3	11.629
	CRR073309	Second white 1	13.014
	CRR073310	Second white 2	16.816
	CRR073311	Second white 3	14.038
	CRR073312	Silver flowering 1	17.212
	CRR073313	Silver flowering 2	13.774
	CRR073314	Silver flowering 3	19.110
	CRR073315	Gold flowering 1	25.981
	CRR073316	Gold flowering 2	21.060
	CRR073317	Gold flowering 3	18.034
	CRR073318	Tawny withering 1	19.024
	CRR073319	Tawny withering 2	22.722
	CRR073320	Tawny withering 3	22.294