Gene detail

Detail information of GWHGAAZE012383

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004236855.1	2.8872E-140	PREDICTED: FAD synthetase 1, chloroplastic [Solanum lycopersicum]
Swissprot	tr\|Q9FMW8\|RIBF1_ARATH	2E-120	FAD synthetase 1, chloroplastic (Precursor)
trEMBL	tr\|K4BP55\|K4BP55_SOLLC	1E-140	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc04g008990.2.1}
TAIR10	AT5G23330.1	1E-97	Nucleotidylyl transferase superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	84653993	84655392	-
GWHAAZE00000003	mRNA	84653993	84655392	-
GWHAAZE00000003	exon	84655259	84655392	-
GWHAAZE00000003	exon	84654846	84655021	-
GWHAAZE00000003	exon	84653993	84654507	-
GWHAAZE00000003	CDS	84655259	84655392	-
GWHAAZE00000003	CDS	84654846	84655021	-
GWHAAZE00000003	CDS	84653993	84654507	-

Transcript Sequence
>GWHTAAZE012397 GGGATAGTAGCTTTAGGAAAGTTTGACGCCCTTCACATCGGTCATCGTGAACTGGCAATCCAAGCCGCGAAGGTTGGGGTCCCATTTCTTTTATCTTTTGTTGGCATGGCTGAAGTGCTTGGCTGGGATCCTAGGGCTCCTATAGTTGCCAAATGTGACCGCAAACGGATTTTCTCCTCTTGGGCTCCATACTGTGGAGAAATGACTCCCAAAGAATTTGAAGTTGATTTTTCAAAAGTTCGGTATCTCTCTCCACGAGAATTTGTTGAGAAGTTATCGAACGAGCTTGGAGTACGTGGTGTAGTAGCGGGCAAAAACTACCGATTTGGATTTAGAGCGGCTGGTGACGCATCAGAGCTGGTGCGACTGTGCAAGGAGTATGGTTTAGGAGCATACATAATAAATTCTGTAATGGACAGGTATCAAGATTCTAGAGAAATGGGCCCAAGTGATACGAAAGAGCAAGGACAGGTGTCATCTACTCGAGTTCGCCATGCTCTTGCCAGGGGAGATATGAAATATGTGTCTGAACTTTTGGGTCGCCAACATCGTCTCATATTAATTGCAAAAGAGAAGGAAGGATTTACCACAAATAGAAATAGGGTGTCGGCCCCAAGGTCTTGTTTGTTAAATCTTCCACCTAAGGTGGGTCGATATGAGAACTGTTCTCTTCTGACTGGTGGTGCTTATAGTGTTGTACCATGCAGAGTACTCATTGATACTACACATATTCATTTAGAATTGGATGAGACAGATGTTTGTATTAACAATACTTCTCAAGAATTTCAGTTCTTGGGTATCGACTTTGGTGATTCGGGATCTTAA

Network for GWHGAAZE012383

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF06574.13	FAD_syn	79	138	9.60E-09

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K22949	RIBF	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Riboflavin metabolism	map00740

Gene Ontology

GO term	Ontology	Name
GO:0009231	biological_process	riboflavin biosynthetic process
GO:0003919	molecular_function	FMN adenylyltransferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	11.856
	SRR3591706	second leaf	16.450
	SRR3591707	mature leaf	16.912
	SRR3591708	Shoot apex	17.882
	SRR3591709	Stem	10.008
	SRR3591710	White floral bud	12.181
	SRR3591711	White flower	18.850
	SRR3591712	Green floral bud	21.207
	SRR3591713	Yellow flower	26.575
SRP173429	SRR8316895	Juvenile bud stage	11.133
	SRR8316896	Juvenile bud stage	14.065
	SRR8316897	Juvenile bud stage	7.843
	SRR8316894	Third green stage	4.880
	SRR8316900	Third green stage	17.285
	SRR8316901	Third green stage	16.669
	SRR8316898	Complete white stage	4.550
	SRR8316899	Complete white stage	17.212
	SRR8316903	Complete white stage	9.027
	SRR8316902	Silver flowering stage	5.221
	SRR8316904	Silver flowering stage	8.178
	SRR8316905	Silver flowering stage	3.509
	SRR8316906	Gold flowering stage	13.459
	SRR8316907	Gold flowering stage	13.116
	SRR8316908	Gold flowering stage	18.470
SRP132670	SRR6706286	Control	18.310
	SRR6706287	Light intensity 50%	16.536
	SRR6706288	Light intensity 20%	16.595
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	19.049
	CNS0095593	Slightly white alabastrum(diploid) 2	17.055
	CNS0095594	Slightly white alabastrum(diploid) 3	16.382
	CNS0095595	Whole white alabastrum(diploid) 2	15.498
	CNS0095596	Whole white alabastrum(diploid) 3	14.963
	CNS0095597	Whole white alabastrum(diploid) 4	16.567
	CNS0095598	Silvery flower (diploied) 1	12.969
	CNS0095599	Silvery flower (diploied) 2	15.249
	CNS0095600	Silvery flower (diploied) 3	12.903
	CNS0095601	Golden flower (diploid) 1	14.665
	CNS0095602	Golden flower (diploid) 2	14.088
	CNS0095603	Golden flower (diploid) 3	13.593
	CNS0095604	Slightly white alabastrum(tetraploid) 1	15.548
	CNS0095605	Slightly white alabastrum(tetraploid) 2	17.426
	CNS0095606	Slightly white alabastrum(tetraploid) 3	19.465
	CNS0095607	Whole white alabastrum(tetraploid) 1	11.389
	CNS0095608	Whole white alabastrum(tetraploid) 2	11.515
	CNS0095609	Whole white alabastrum(tetraploid) 3	12.772
	CNS0095610	Silvery flower (tetraploid) 1	16.815
	CNS0095611	Silvery flower (tetraploid) 2	18.396
	CNS0095612	Silvery flower (tetraploid) 3	11.204
	CNS0095613	Golden flower (tetraploid) 1	20.851
	CNS0095614	Golden flower (tetraploid) 2	20.244
	CNS0095615	Golden flower (tetraploid) 3	16.113
CRA001975	CRR073297	Stem 1	9.580
	CRR073298	Stem 2	9.343
	CRR073299	Stem 3	8.586
	CRR073300	Leaf 1	9.354
	CRR073301	Leaf 2	11.146
	CRR073302	Leaf 3	9.914
	CRR073303	Juvenile bud 1	9.659
	CRR073304	Juvenile bud 2	7.679
	CRR073305	Juvenile bud 3	9.045
	CRR073306	Third green 1	2.164
	CRR073307	Third green 2	3.466
	CRR073308	Third green 3	2.646
	CRR073309	Second white 1	6.827
	CRR073310	Second white 2	6.410
	CRR073311	Second white 3	4.804
	CRR073312	Silver flowering 1	7.091
	CRR073313	Silver flowering 2	10.839
	CRR073314	Silver flowering 3	2.044
	CRR073315	Gold flowering 1	15.987
	CRR073316	Gold flowering 2	16.455
	CRR073317	Gold flowering 3	10.916
	CRR073318	Tawny withering 1	5.972
	CRR073319	Tawny withering 2	5.348
	CRR073320	Tawny withering 3	4.801