Gene detail

Detail information of GWHGAAZE012333

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010040181.1	5.65583E-50	PREDICTED: ubiquitin-40S ribosomal protein S27a-like [Eucalyptus grandis]
Swissprot	tr\|P62981\|RS27A_SOLTU	2E-50	40S ribosomal protein S27a (Precursor)
trEMBL	tr\|A0A058ZUJ2\|A0A058ZUJ2_EUCGR	2E-50	Uncharacterized protein {ECO:0000313\|EMBL:KCW45422.1}
TAIR10	AT2G47110.2	2E-25	ubiquitin 6

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	83887085	83887324	-
GWHAAZE00000003	mRNA	83887085	83887324	-
GWHAAZE00000003	exon	83887085	83887324	-
GWHAAZE00000003	CDS	83887085	83887324	-

Transcript Sequence
>GWHTAAZE012347 AAGAAGAGGAAGAAGAAGACCTACACCAAGCCTAAGAAGATCAAGCACAAGAAGAAGAAGGTCAAGCTTGCAGTTCTGCAGTTCTATAAGGTAGATGATTCTGGAAAGGTTCAGAGATTGAGGAAGGAGTGCCCAAATGGCGAGTGTGGTGCTGGAACTTTCATGGCGAATCATTTTGATCGTCATTACTGTGGTAAGTGTGGGCTTACCTATGTTTACCAGAAGGCTGGTGGCGACTGA

Network for GWHGAAZE012333

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01599.20	Ribosomal_S27	25	70	4.80E-27

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02977	RP-S27Ae, RPS27A, UBA80	Ribosome	map03010
		Ubiquitin mediated proteolysis	map04120
		Mitophagy - animal	map04137

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	461.601
	SRR3591706	second leaf	203.267
	SRR3591707	mature leaf	116.969
	SRR3591708	Shoot apex	714.258
	SRR3591709	Stem	256.528
	SRR3591710	White floral bud	158.952
	SRR3591711	White flower	197.627
	SRR3591712	Green floral bud	373.530
	SRR3591713	Yellow flower	105.320
SRP173429	SRR8316895	Juvenile bud stage	300.078
	SRR8316896	Juvenile bud stage	389.039
	SRR8316897	Juvenile bud stage	231.745
	SRR8316894	Third green stage	153.048
	SRR8316900	Third green stage	475.242
	SRR8316901	Third green stage	473.701
	SRR8316898	Complete white stage	57.310
	SRR8316899	Complete white stage	351.345
	SRR8316903	Complete white stage	107.074
	SRR8316902	Silver flowering stage	44.267
	SRR8316904	Silver flowering stage	52.211
	SRR8316905	Silver flowering stage	26.762
	SRR8316906	Gold flowering stage	61.393
	SRR8316907	Gold flowering stage	72.888
	SRR8316908	Gold flowering stage	81.111
SRP132670	SRR6706286	Control	383.063
	SRR6706287	Light intensity 50%	380.934
	SRR6706288	Light intensity 20%	415.446
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	480.447
	CNS0095593	Slightly white alabastrum(diploid) 2	549.540
	CNS0095594	Slightly white alabastrum(diploid) 3	487.158
	CNS0095595	Whole white alabastrum(diploid) 2	425.639
	CNS0095596	Whole white alabastrum(diploid) 3	489.519
	CNS0095597	Whole white alabastrum(diploid) 4	348.187
	CNS0095598	Silvery flower (diploied) 1	246.750
	CNS0095599	Silvery flower (diploied) 2	208.558
	CNS0095600	Silvery flower (diploied) 3	143.701
	CNS0095601	Golden flower (diploid) 1	223.923
	CNS0095602	Golden flower (diploid) 2	163.064
	CNS0095603	Golden flower (diploid) 3	169.677
	CNS0095604	Slightly white alabastrum(tetraploid) 1	331.611
	CNS0095605	Slightly white alabastrum(tetraploid) 2	353.305
	CNS0095606	Slightly white alabastrum(tetraploid) 3	371.642
	CNS0095607	Whole white alabastrum(tetraploid) 1	194.027
	CNS0095608	Whole white alabastrum(tetraploid) 2	182.068
	CNS0095609	Whole white alabastrum(tetraploid) 3	287.351
	CNS0095610	Silvery flower (tetraploid) 1	83.130
	CNS0095611	Silvery flower (tetraploid) 2	98.833
	CNS0095612	Silvery flower (tetraploid) 3	67.476
	CNS0095613	Golden flower (tetraploid) 1	55.909
	CNS0095614	Golden flower (tetraploid) 2	85.149
	CNS0095615	Golden flower (tetraploid) 3	49.878
CRA001975	CRR073297	Stem 1	422.585
	CRR073298	Stem 2	454.607
	CRR073299	Stem 3	465.691
	CRR073300	Leaf 1	374.056
	CRR073301	Leaf 2	405.902
	CRR073302	Leaf 3	496.201
	CRR073303	Juvenile bud 1	364.629
	CRR073304	Juvenile bud 2	257.915
	CRR073305	Juvenile bud 3	278.301
	CRR073306	Third green 1	35.569
	CRR073307	Third green 2	46.396
	CRR073308	Third green 3	45.896
	CRR073309	Second white 1	41.401
	CRR073310	Second white 2	33.271
	CRR073311	Second white 3	19.419
	CRR073312	Silver flowering 1	27.355
	CRR073313	Silver flowering 2	39.424
	CRR073314	Silver flowering 3	32.728
	CRR073315	Gold flowering 1	172.198
	CRR073316	Gold flowering 2	170.959
	CRR073317	Gold flowering 3	172.125
	CRR073318	Tawny withering 1	293.519
	CRR073319	Tawny withering 2	303.048
	CRR073320	Tawny withering 3	287.916