Gene detail

Detail information of GWHGAAZE012225

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDO98863.1	2.07756E-64	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q8GYL3\|ULP1A_ARATH	3E-51	Ubiquitin-like-specific protease 1A
trEMBL	tr\|A0A068TU36\|A0A068TU36_COFCA	8E-65	Coffea canephora DH200=94 genomic scaffold, scaffold_3 {ECO:0000313\|EMBL:CDO98863.1}
TAIR10	AT3G06910.1	7E-44	UB-like protease 1A

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	82010866	82012302	+
GWHAAZE00000003	mRNA	82010866	82012302	+
GWHAAZE00000003	exon	82010866	82010913	+
GWHAAZE00000003	exon	82011012	82011131	+
GWHAAZE00000003	exon	82011722	82011825	+
GWHAAZE00000003	exon	82012200	82012302	+
GWHAAZE00000003	CDS	82010866	82010913	+
GWHAAZE00000003	CDS	82011012	82011131	+
GWHAAZE00000003	CDS	82011722	82011825	+
GWHAAZE00000003	CDS	82012200	82012302	+

Transcript Sequence
>GWHTAAZE012239 ATGGACTACGAGAGGAAGTTGGGGTACTGCCTTCTTGACTGTGACAAAATATTTGTTCCTATCCACAAAGAAGTACATTGGTGCTTAGCAATTATCAATAATAAGGATAAGAAGTTCCAGTATCTTGATTCACTAAAAGGAGTTGATAGGCAAGTAATGAAAGTACTGGCTAGATACTTTGTGGATGAGGTGAAGGACAAGAGTGGGAAGGACATTGATGTGAATTCTTGGAAGCAAGAATATGTTCAGGACCTTCCCGATCAGGAGAATGGGTACGACTGTGGTATGTTCATGATCAAATATGCCGACTTCTATAGCAGGGACATAGGACTCTGTTTTAAGCAGGTAAGCCACATGCCGGTGACTTTATGTTGA

Network for GWHGAAZE012225

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02902.20	Peptidase_C48	10	108	3.10E-28

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	ULP

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006508	biological_process	proteolysis
GO:0008234	molecular_function	cysteine-type peptidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.522
	SRR3591706	second leaf	4.172
	SRR3591707	mature leaf	4.530
	SRR3591708	Shoot apex	4.315
	SRR3591709	Stem	4.940
	SRR3591710	White floral bud	5.025
	SRR3591711	White flower	4.271
	SRR3591712	Green floral bud	5.183
	SRR3591713	Yellow flower	3.971
SRP173429	SRR8316895	Juvenile bud stage	2.347
	SRR8316896	Juvenile bud stage	4.613
	SRR8316897	Juvenile bud stage	0.854
	SRR8316894	Third green stage	2.052
	SRR8316900	Third green stage	3.954
	SRR8316901	Third green stage	3.567
	SRR8316898	Complete white stage	0.922
	SRR8316899	Complete white stage	5.058
	SRR8316903	Complete white stage	2.475
	SRR8316902	Silver flowering stage	1.556
	SRR8316904	Silver flowering stage	1.500
	SRR8316905	Silver flowering stage	0.554
	SRR8316906	Gold flowering stage	1.656
	SRR8316907	Gold flowering stage	2.663
	SRR8316908	Gold flowering stage	2.699
SRP132670	SRR6706286	Control	0.158
	SRR6706287	Light intensity 50%	0.207
	SRR6706288	Light intensity 20%	0.356
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.266
	CNS0095593	Slightly white alabastrum(diploid) 2	4.390
	CNS0095594	Slightly white alabastrum(diploid) 3	5.125
	CNS0095595	Whole white alabastrum(diploid) 2	3.582
	CNS0095596	Whole white alabastrum(diploid) 3	4.660
	CNS0095597	Whole white alabastrum(diploid) 4	2.216
	CNS0095598	Silvery flower (diploied) 1	5.620
	CNS0095599	Silvery flower (diploied) 2	4.717
	CNS0095600	Silvery flower (diploied) 3	2.357
	CNS0095601	Golden flower (diploid) 1	4.872
	CNS0095602	Golden flower (diploid) 2	3.583
	CNS0095603	Golden flower (diploid) 3	2.060
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.141
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.690
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.604
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.451
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.902
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.734
	CNS0095610	Silvery flower (tetraploid) 1	2.209
	CNS0095611	Silvery flower (tetraploid) 2	2.373
	CNS0095612	Silvery flower (tetraploid) 3	3.575
	CNS0095613	Golden flower (tetraploid) 1	2.441
	CNS0095614	Golden flower (tetraploid) 2	3.759
	CNS0095615	Golden flower (tetraploid) 3	2.279
CRA001975	CRR073297	Stem 1	1.560
	CRR073298	Stem 2	2.487
	CRR073299	Stem 3	1.049
	CRR073300	Leaf 1	0.758
	CRR073301	Leaf 2	1.051
	CRR073302	Leaf 3	0.278
	CRR073303	Juvenile bud 1	0.369
	CRR073304	Juvenile bud 2	0.109
	CRR073305	Juvenile bud 3	0.816
	CRR073306	Third green 1	0.074
	CRR073307	Third green 2	0.144
	CRR073308	Third green 3	0.371
	CRR073309	Second white 1	0.536
	CRR073310	Second white 2	0.696
	CRR073311	Second white 3	0.292
	CRR073312	Silver flowering 1	1.356
	CRR073313	Silver flowering 2	1.337
	CRR073314	Silver flowering 3	0.286
	CRR073315	Gold flowering 1	0.700
	CRR073316	Gold flowering 2	0.337
	CRR073317	Gold flowering 3	0.184
	CRR073318	Tawny withering 1	1.680
	CRR073319	Tawny withering 2	0.675
	CRR073320	Tawny withering 3	0.545