Gene detail

Detail information of GWHGAAZE012219

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDO71642.1	3.4569E-63	hypothetical protein CISIN_1g042873mg [Citrus sinensis]
Swissprot	tr\|O82245\|TSPO_ARATH	3E-36	Translocator protein homolog
trEMBL	tr\|A0A067G7W6\|A0A067G7W6_CITSI	1E-63	Uncharacterized protein {ECO:0000313\|EMBL:KDO71642.1}
TAIR10	AT2G47770.1	1E-25	TSPO(outer membrane tryptophan-rich sensory protein)-related

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	81948779	81949204	+
GWHAAZE00000003	mRNA	81948779	81949204	+
GWHAAZE00000003	exon	81948779	81949204	+
GWHAAZE00000003	CDS	81948779	81949204	+

Transcript Sequence
>GWHTAAZE012233 ATGGTCCCTCTCGCATTAACCATGGCCACAATATTCTTCTTTGGCTCGGCTCGAAAGTACCGGGCTTTGGCTAAGCCGTTTTGGTTCCCACCGCCGTGGCTAATGCACTTGGCTTCATTGGGCTCGTCTTTCTTTATGGGATTATCGTCATGGCTAGTGTGGGCCGAGGGCGGTTTCCATAACGAATCGGATGCGTTGCCTCTATACATCGCCCAATTGTCTCTTAGTATTATTTGGGATCCGCTTGTGCTTAAAATCGGAGCCGTTCGCATGGGCTTGGTTTTCTGTGTAGTGCATTTTGGGACGCTTGTTGCTTGTCGCCGGAAGTTTAAAATGGTGAATCCGATCGCCGGAGATCTTGTAAGGCCGTGTTTGGCTTGGATTGCTTTTCTTACTACCGTCAATTGCAAGCTTATATTCCTTTGA

Network for GWHGAAZE012219

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03073.16	TspO_MBR	2	138	8.40E-27

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K05770	TSPO, BZRP	Neuroactive ligand-receptor interaction	map04080
		Apoptosis - fly	map04214
		Cholesterol metabolism	map04979

Gene Ontology

GO term	Ontology	Name
GO:0016021	cellular_component	integral component of membrane

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.089
	SRR3591710	White floral bud	7.864
	SRR3591711	White flower	0.342
	SRR3591712	Green floral bud	11.231
	SRR3591713	Yellow flower	0.226
SRP173429	SRR8316895	Juvenile bud stage	3.501
	SRR8316896	Juvenile bud stage	7.494
	SRR8316897	Juvenile bud stage	2.780
	SRR8316894	Third green stage	1.287
	SRR8316900	Third green stage	7.617
	SRR8316901	Third green stage	6.501
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.123
	SRR8316904	Silver flowering stage	0.238
	SRR8316905	Silver flowering stage	0.040
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	2.083
	SRR6706287	Light intensity 50%	2.415
	SRR6706288	Light intensity 20%	2.642
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	7.310
	CNS0095593	Slightly white alabastrum(diploid) 2	7.161
	CNS0095594	Slightly white alabastrum(diploid) 3	8.844
	CNS0095595	Whole white alabastrum(diploid) 2	13.426
	CNS0095596	Whole white alabastrum(diploid) 3	15.158
	CNS0095597	Whole white alabastrum(diploid) 4	15.098
	CNS0095598	Silvery flower (diploied) 1	0.672
	CNS0095599	Silvery flower (diploied) 2	1.103
	CNS0095600	Silvery flower (diploied) 3	0.170
	CNS0095601	Golden flower (diploid) 1	0.092
	CNS0095602	Golden flower (diploid) 2	0.392
	CNS0095603	Golden flower (diploid) 3	0.126
	CNS0095604	Slightly white alabastrum(tetraploid) 1	10.608
	CNS0095605	Slightly white alabastrum(tetraploid) 2	13.639
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.020
	CNS0095607	Whole white alabastrum(tetraploid) 1	28.944
	CNS0095608	Whole white alabastrum(tetraploid) 2	31.024
	CNS0095609	Whole white alabastrum(tetraploid) 3	12.848
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.708
	CNS0095612	Silvery flower (tetraploid) 3	2.760
	CNS0095613	Golden flower (tetraploid) 1	0.478
	CNS0095614	Golden flower (tetraploid) 2	0.187
	CNS0095615	Golden flower (tetraploid) 3	0.605
CRA001975	CRR073297	Stem 1	2.238
	CRR073298	Stem 2	2.492
	CRR073299	Stem 3	3.004
	CRR073300	Leaf 1	6.427
	CRR073301	Leaf 2	4.033
	CRR073302	Leaf 3	3.426
	CRR073303	Juvenile bud 1	10.756
	CRR073304	Juvenile bud 2	16.849
	CRR073305	Juvenile bud 3	0.687
	CRR073306	Third green 1	4.791
	CRR073307	Third green 2	5.617
	CRR073308	Third green 3	2.049
	CRR073309	Second white 1	0.147
	CRR073310	Second white 2	0.195
	CRR073311	Second white 3	0.320
	CRR073312	Silver flowering 1	2.848
	CRR073313	Silver flowering 2	4.935
	CRR073314	Silver flowering 3	1.465
	CRR073315	Gold flowering 1	6.039
	CRR073316	Gold flowering 2	0.962
	CRR073317	Gold flowering 3	1.064
	CRR073318	Tawny withering 1	2.949
	CRR073319	Tawny withering 2	3.175
	CRR073320	Tawny withering 3	3.312