Gene detail

Detail information of GWHGAAZE012200

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDO71642.1	1.73578E-68	hypothetical protein CISIN_1g042873mg [Citrus sinensis]
Swissprot	tr\|O82245\|TSPO_ARATH	1E-42	Translocator protein homolog
trEMBL	tr\|A0A067G7W6\|A0A067G7W6_CITSI	6E-69	Uncharacterized protein {ECO:0000313\|EMBL:KDO71642.1}
TAIR10	AT2G47770.1	6E-31	TSPO(outer membrane tryptophan-rich sensory protein)-related

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	81682222	81682686	+
GWHAAZE00000003	mRNA	81682222	81682686	+
GWHAAZE00000003	exon	81682222	81682686	+
GWHAAZE00000003	CDS	81682222	81682686	+

Transcript Sequence
>GWHTAAZE012214 ATGGCCAAACGGGCGCTTAGGTCCCTAAGCGTCGCACTTATGGTCCCTCTCGCATTAACCATGGCCACAATATTCTTCTTTGGCTCGGCTCGAAAGTACCGGGCTTTGGCTAAGCCGTTTTGGTTCCCACCGCCGTGGCTAATGCACTTGGCTTCATTGGGCTCGTCTTTCTTTATGGGATTATCGTCATGGCTAGTGTGGGCCGAGGGCGGTTTCCATAACGAATCGGATGCGTTGCCTCTATACATCGCCCAATTGTCTCTTAGTATTATTTGGGATCCGCTTGTGCTTAAAATCGGAGCCGTTCGCATGGGCTTGGTTTTCTGTGTAGTGCATTTTGGGACGCTTGTTGCTTGTCGCCGGAAGTTTAAAATGGTGAATCCGATCGCCGGAGATCTTGTAAGGCCGTGTTTGGCTTGGATTGCTTTTCTTACTACCGTCAATTGCAAGCTTATATTCCTTTGA

Network for GWHGAAZE012200

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03073.16	TspO_MBR	11	151	4.20E-27

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K05770	TSPO, BZRP	Neuroactive ligand-receptor interaction	map04080
		Apoptosis - fly	map04214
		Cholesterol metabolism	map04979

Gene Ontology

GO term	Ontology	Name
GO:0016021	cellular_component	integral component of membrane

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.102
	SRR3591710	White floral bud	9.253
	SRR3591711	White flower	0.355
	SRR3591712	Green floral bud	12.042
	SRR3591713	Yellow flower	0.225
SRP173429	SRR8316895	Juvenile bud stage	4.821
	SRR8316896	Juvenile bud stage	10.832
	SRR8316897	Juvenile bud stage	3.385
	SRR8316894	Third green stage	2.144
	SRR8316900	Third green stage	9.201
	SRR8316901	Third green stage	9.373
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.123
	SRR8316902	Silver flowering stage	0.174
	SRR8316904	Silver flowering stage	0.317
	SRR8316905	Silver flowering stage	0.066
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	3.877
	SRR6706287	Light intensity 50%	3.912
	SRR6706288	Light intensity 20%	4.247
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	9.355
	CNS0095593	Slightly white alabastrum(diploid) 2	8.916
	CNS0095594	Slightly white alabastrum(diploid) 3	11.801
	CNS0095595	Whole white alabastrum(diploid) 2	16.441
	CNS0095596	Whole white alabastrum(diploid) 3	18.408
	CNS0095597	Whole white alabastrum(diploid) 4	18.615
	CNS0095598	Silvery flower (diploied) 1	1.337
	CNS0095599	Silvery flower (diploied) 2	1.185
	CNS0095600	Silvery flower (diploied) 3	0.486
	CNS0095601	Golden flower (diploid) 1	0.476
	CNS0095602	Golden flower (diploid) 2	0.422
	CNS0095603	Golden flower (diploid) 3	0.184
	CNS0095604	Slightly white alabastrum(tetraploid) 1	14.012
	CNS0095605	Slightly white alabastrum(tetraploid) 2	18.072
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.072
	CNS0095607	Whole white alabastrum(tetraploid) 1	35.686
	CNS0095608	Whole white alabastrum(tetraploid) 2	42.412
	CNS0095609	Whole white alabastrum(tetraploid) 3	18.633
	CNS0095610	Silvery flower (tetraploid) 1	0.142
	CNS0095611	Silvery flower (tetraploid) 2	1.194
	CNS0095612	Silvery flower (tetraploid) 3	3.854
	CNS0095613	Golden flower (tetraploid) 1	0.441
	CNS0095614	Golden flower (tetraploid) 2	0.224
	CNS0095615	Golden flower (tetraploid) 3	1.033
CRA001975	CRR073297	Stem 1	2.415
	CRR073298	Stem 2	3.763
	CRR073299	Stem 3	4.143
	CRR073300	Leaf 1	7.476
	CRR073301	Leaf 2	4.368
	CRR073302	Leaf 3	4.789
	CRR073303	Juvenile bud 1	13.934
	CRR073304	Juvenile bud 2	19.746
	CRR073305	Juvenile bud 3	0.630
	CRR073306	Third green 1	5.164
	CRR073307	Third green 2	4.870
	CRR073308	Third green 3	2.925
	CRR073309	Second white 1	0.134
	CRR073310	Second white 2	0.182
	CRR073311	Second white 3	0.347
	CRR073312	Silver flowering 1	3.238
	CRR073313	Silver flowering 2	3.437
	CRR073314	Silver flowering 3	1.834
	CRR073315	Gold flowering 1	5.652
	CRR073316	Gold flowering 2	1.021
	CRR073317	Gold flowering 3	1.233
	CRR073318	Tawny withering 1	3.287
	CRR073319	Tawny withering 2	3.592
	CRR073320	Tawny withering 3	3.161