Gene detail

Detail information of GWHGAAZE011897

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	EYU44215.1	1.56109E-50	hypothetical protein MIMGU_mgv1a000477mg [Erythranthe guttata]
Swissprot	tr\|Q3E8W4\|ANX2_ARATH	9E-45	Receptor-like protein kinase ANXUR2 (Precursor)
trEMBL	tr\|A0A022RZ14\|A0A022RZ14_ERYGU	6E-51	Uncharacterized protein {ECO:0000313\|EMBL:EYU44215.1}
TAIR10	AT5G28680.1	2E-40	Malectin/receptor-like protein kinase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	74987774	74988571	-
GWHAAZE00000003	mRNA	74987774	74988571	-
GWHAAZE00000003	exon	74987774	74988571	-
GWHAAZE00000003	CDS	74987774	74988571	-

Transcript Sequence
>GWHTAAZE011909 ATGAAGAGTTCGAACATCCTTTTAGATAAGAATTTCGCAGCTAAAGTTTCAGATTTTGAGTTGTCTAGAATATGCCCAATTGATCAGTCATGCACTCATATCAAAACAAATGTTAAAGGGACAACGGGGTATGTGGATCCAGAATATATGTTGACCTTCAAATTAACAAGGAAATCTGATGTCTATTCTTTTGGGGTTGTACTATTCGAAGTGTTGTGTGGAAGACGAGCGGTGGATTTTAGTCTTGATGAAGAGCAATGGAGTCTTGCAAGGTGGGCACAATACTGTACTGAAAATGGAACACTTCATCATATTATCGATCCTAATTTGAAGTGGGAAATCTTGCCGGAATCTTTTACGGAGTTTGCACGAATTGCAAATCAATGTTTATGTTATAAGTCAAAAAAGCGCCCCACGATGACTCAAGTCGTGGCGTCACTCGACTTAGCCTTGACATTGCAGCTAGGACGCCAAGATTCTTCTGCATTTGAAATGGAAATTACTGGTACAAGCGAGGCAGATGAAATCATAGAGAATGTTGATTCAACAATGGTACAACAAGATGCTACCAAATCTGGGAGTCGGGACGAAGATAATAATGATGTCCCACCGTCTCATGTAAAGCCTAGAAAAAAAAAGTGGCTCAGTAAAATATTGCAACCGTTTATGTTTCGGACTGACGCAGGTAAGACCATATTGATTACACAAACAATGCTATATAGCGTAAAAAAATTCCAAAGGCACGATTTAAAGTATCTTTCAACCAATCGATATTATTTATCGATTTTTCTTTCTTAG

Network for GWHGAAZE011897

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00069.26	Pkinase	1	145	9.30E-19

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_CrRLK1L-1

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.524
	SRR3591706	second leaf	0.310
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.491
	SRR3591709	Stem	3.135
	SRR3591710	White floral bud	0.473
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.255
	SRR3591713	Yellow flower	0.218
SRP173429	SRR8316895	Juvenile bud stage	1.458
	SRR8316896	Juvenile bud stage	0.571
	SRR8316897	Juvenile bud stage	0.530
	SRR8316894	Third green stage	0.227
	SRR8316900	Third green stage	0.088
	SRR8316901	Third green stage	0.806
	SRR8316898	Complete white stage	0.078
	SRR8316899	Complete white stage	1.031
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.046
	SRR8316907	Gold flowering stage	0.275
	SRR8316908	Gold flowering stage	0.106
SRP132670	SRR6706286	Control	0.168
	SRR6706287	Light intensity 50%	0.205
	SRR6706288	Light intensity 20%	0.029
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.211
	CNS0095593	Slightly white alabastrum(diploid) 2	1.612
	CNS0095594	Slightly white alabastrum(diploid) 3	0.561
	CNS0095595	Whole white alabastrum(diploid) 2	0.860
	CNS0095596	Whole white alabastrum(diploid) 3	0.425
	CNS0095597	Whole white alabastrum(diploid) 4	0.480
	CNS0095598	Silvery flower (diploied) 1	0.523
	CNS0095599	Silvery flower (diploied) 2	0.780
	CNS0095600	Silvery flower (diploied) 3	0.373
	CNS0095601	Golden flower (diploid) 1	0.341
	CNS0095602	Golden flower (diploid) 2	0.515
	CNS0095603	Golden flower (diploid) 3	0.157
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.038
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.112
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.150
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.211
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.537
	CRR073298	Stem 2	0.434
	CRR073299	Stem 3	0.100
	CRR073300	Leaf 1	0.345
	CRR073301	Leaf 2	1.825
	CRR073302	Leaf 3	0.465
	CRR073303	Juvenile bud 1	0.281
	CRR073304	Juvenile bud 2	0.062
	CRR073305	Juvenile bud 3	0.463
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.028
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.076
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.284
	CRR073315	Gold flowering 1	0.065
	CRR073316	Gold flowering 2	0.909
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.164
	CRR073319	Tawny withering 2	0.386
	CRR073320	Tawny withering 3	0.335