Gene detail

Detail information of GWHGAAZE011703

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007099762.1	7.13166E-42	Malectin/receptor protein kinase family protein [Theobroma cacao]
Swissprot	tr\|Q9FID9\|Y5389_ARATH	3E-36	Probable receptor-like protein kinase At5g38990 (Precursor)
trEMBL	tr\|M0TMD5\|M0TMD5_MUSAM	2E-43	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GSMUA_Achr8P03820_001}
TAIR10	AT5G38990.1	4E-33	Malectin/receptor-like protein kinase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	71725486	71726709	+
GWHAAZE00000003	mRNA	71725486	71726709	+
GWHAAZE00000003	exon	71725486	71725874	+
GWHAAZE00000003	exon	71726234	71726627	+
GWHAAZE00000003	exon	71726695	71726709	+
GWHAAZE00000003	CDS	71725486	71725874	+
GWHAAZE00000003	CDS	71726234	71726627	+
GWHAAZE00000003	CDS	71726695	71726709	+

Transcript Sequence
>GWHTAAZE011715 ATGATCTGCAGCAGAGTGATGATGCTGGTAGCGCCACCCCCAGTACACTTAAACAGGCCGCCGTTGGATCCGCCAGAGCAATTCTGCCGTCCCTTCTCCCTTGCTGAGATCTTATCCGCAACTAACAACTTCGACGAGTCATTGGTTATTGGGCAGGGCGGATTTGGTAAAGTATACAAAGGGGTCATTGACAATGCGGCAAGTATCGTTGCTATAAAACGGCTAAGTCATGAATCCAAGCAAGGAGATTCTGAATTCAGAACCGAGATTGAGATGCTCTCGAAATTTCGACACTCTCATATCGTGTCTCTAATCCGTTATTGCTATAGTTCTACTGAGATGATCCTTGTTTATCAATATGTGGTCAACGGATCTCTGGCAGATCACTTACGAGCGGTGGATTTTAGTCTTGATGAAGAGCAATGGAGTCTTGCAAGGTGGGCACAATACTATACTGAAAATGGAACACTTCATTGTATTATCGATCCTAATTTGAAGTGGGAAATCTTGCCGGAATCTTTTACGGAGTTTGCACGAATTGCAAATGAATGTTTATGTTATCAGTCAGAAAAGCGCCCCACGATGACTCAAGTCGTGGCGTCACTCGACTTAGCCTTGACATTGCAGCTAGGACGCAAAGATTCTTCTGCATTTGAAATGGAAATTACTGGTACAAGCGAGGCAGATGAAATCATAGAGAATGTTGATTCAACAATGGTACAACAAGATGCTACCAAATCTGGGAGTCGTGACGAAGATAATAATGATGTCCCACCGTCTCATTTAAGACCATATTGA

Network for GWHGAAZE011703

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00069.26	Pkinase	48	141	4.20E-19

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_CrRLK1L-1

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0005524	molecular_function	ATP binding
GO:0004672	molecular_function	protein kinase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.566
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.052
	SRR3591708	Shoot apex	0.191
	SRR3591709	Stem	0.542
	SRR3591710	White floral bud	0.307
	SRR3591711	White flower	0.330
	SRR3591712	Green floral bud	0.186
	SRR3591713	Yellow flower	0.407
SRP173429	SRR8316895	Juvenile bud stage	1.581
	SRR8316896	Juvenile bud stage	0.390
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.416
	SRR8316900	Third green stage	0.240
	SRR8316901	Third green stage	1.562
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	2.156
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.415
	SRR8316907	Gold flowering stage	0.248
	SRR8316908	Gold flowering stage	0.287
SRP132670	SRR6706286	Control	0.348
	SRR6706287	Light intensity 50%	0.183
	SRR6706288	Light intensity 20%	0.089
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.938
	CNS0095593	Slightly white alabastrum(diploid) 2	1.621
	CNS0095594	Slightly white alabastrum(diploid) 3	1.053
	CNS0095595	Whole white alabastrum(diploid) 2	1.171
	CNS0095596	Whole white alabastrum(diploid) 3	0.384
	CNS0095597	Whole white alabastrum(diploid) 4	1.052
	CNS0095598	Silvery flower (diploied) 1	2.477
	CNS0095599	Silvery flower (diploied) 2	2.018
	CNS0095600	Silvery flower (diploied) 3	0.882
	CNS0095601	Golden flower (diploid) 1	1.038
	CNS0095602	Golden flower (diploid) 2	0.677
	CNS0095603	Golden flower (diploid) 3	0.530
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.043
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.175
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.156
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.051
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.152
	CNS0095610	Silvery flower (tetraploid) 1	0.214
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.024
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	1.128
	CRR073298	Stem 2	1.737
	CRR073299	Stem 3	0.230
	CRR073300	Leaf 1	2.241
	CRR073301	Leaf 2	3.114
	CRR073302	Leaf 3	0.920
	CRR073303	Juvenile bud 1	1.510
	CRR073304	Juvenile bud 2	1.147
	CRR073305	Juvenile bud 3	2.765
	CRR073306	Third green 1	0.169
	CRR073307	Third green 2	0.116
	CRR073308	Third green 3	0.183
	CRR073309	Second white 1	0.057
	CRR073310	Second white 2	0.241
	CRR073311	Second white 3	0.152
	CRR073312	Silver flowering 1	0.285
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	1.129
	CRR073315	Gold flowering 1	1.727
	CRR073316	Gold flowering 2	3.223
	CRR073317	Gold flowering 3	0.609
	CRR073318	Tawny withering 1	1.413
	CRR073319	Tawny withering 2	0.805
	CRR073320	Tawny withering 3	0.277