Gene detail

Detail information of GWHGAAZE011694

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ACI05941.1	2.07683E-58	kinase-like protein pac.pt.10.301, partial [Platanus x acerifolia]
Swissprot	tr\|Q9SCZ4\|FERON_ARATH	2E-56	Receptor-like protein kinase FERONIA (Precursor)
trEMBL	tr\|B6D3P4\|B6D3P4_PLAAC	8E-59	Kinase-like protein pac.pt.10.310 {ECO:0000313\|EMBL:ACI05944.1} (Fragment)
TAIR10	AT3G51550.1	3E-49	Malectin/receptor-like protein kinase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	71576258	71576743	-
GWHAAZE00000003	mRNA	71576258	71576743	-
GWHAAZE00000003	exon	71576258	71576743	-
GWHAAZE00000003	CDS	71576258	71576743	-

Transcript Sequence
>GWHTAAZE011706 ATGCTTTCGAAATTCCGTCATTCTCATATTGTGTCTCTAGTCGGTTATTGTTATAATTCTAGTGAGATGATCCTTATTTATGAATATATGAGTAATGGATCTCTCGCAGATCATCTTTACAAAACAAATGATGACGGTAGTACTGGTTGTGCTTTATCTTGGGTGCAACGCCTAAAGATTTGTCTAGGAGCTGCTCGTGGCCTGGATTACCTTCATACAGGTACATGTACTGATGTTCAAGATGGCATCATACATCGTGACGTGAAGAGTTCAAACATTTTGTTAGATAAGCATTGGGTAGCTAGAGTTTCAGACTTCGGGCTCTCTAAAACAAACCGAATTAATCACTCATGTGTGCATACCAAGGTTGGAGGCACCATAGGGTACATGGATCCAGAATATGCATTGACCCAAAGATTGAGAATGAACTCCGACATTTACTCTTTTGGGGTTGTCTTGTTCAAGTGCTGTGTGGAAGGAGAGTGA

Network for GWHGAAZE011694

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF07714.18	PK_Tyr_Ser-Thr	1	160	5.80E-32

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_CrRLK1L-1

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	8.713
	SRR3591706	second leaf	1.375
	SRR3591707	mature leaf	0.793
	SRR3591708	Shoot apex	2.825
	SRR3591709	Stem	5.525
	SRR3591710	White floral bud	1.161
	SRR3591711	White flower	2.290
	SRR3591712	Green floral bud	1.026
	SRR3591713	Yellow flower	0.344
SRP173429	SRR8316895	Juvenile bud stage	1.707
	SRR8316896	Juvenile bud stage	0.920
	SRR8316897	Juvenile bud stage	0.817
	SRR8316894	Third green stage	0.584
	SRR8316900	Third green stage	0.598
	SRR8316901	Third green stage	0.426
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	2.860
	SRR8316903	Complete white stage	0.181
	SRR8316902	Silver flowering stage	0.069
	SRR8316904	Silver flowering stage	0.152
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.917
	SRR8316907	Gold flowering stage	0.159
	SRR8316908	Gold flowering stage	0.604
SRP132670	SRR6706286	Control	0.298
	SRR6706287	Light intensity 50%	0.149
	SRR6706288	Light intensity 20%	0.075
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.128
	CNS0095593	Slightly white alabastrum(diploid) 2	0.726
	CNS0095594	Slightly white alabastrum(diploid) 3	2.247
	CNS0095595	Whole white alabastrum(diploid) 2	1.154
	CNS0095596	Whole white alabastrum(diploid) 3	0.130
	CNS0095597	Whole white alabastrum(diploid) 4	0.346
	CNS0095598	Silvery flower (diploied) 1	1.985
	CNS0095599	Silvery flower (diploied) 2	1.165
	CNS0095600	Silvery flower (diploied) 3	1.038
	CNS0095601	Golden flower (diploid) 1	4.426
	CNS0095602	Golden flower (diploid) 2	1.737
	CNS0095603	Golden flower (diploid) 3	1.857
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.239
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.062
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.183
	CNS0095610	Silvery flower (tetraploid) 1	0.223
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.070
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.313
	CRR073298	Stem 2	0.895
	CRR073299	Stem 3	0.987
	CRR073300	Leaf 1	1.436
	CRR073301	Leaf 2	0.641
	CRR073302	Leaf 3	0.951
	CRR073303	Juvenile bud 1	0.114
	CRR073304	Juvenile bud 2	0.041
	CRR073305	Juvenile bud 3	1.098
	CRR073306	Third green 1	0.106
	CRR073307	Third green 2	0.506
	CRR073308	Third green 3	0.385
	CRR073309	Second white 1	0.083
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.051
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.362
	CRR073315	Gold flowering 1	0.377
	CRR073316	Gold flowering 2	1.257
	CRR073317	Gold flowering 3	0.789
	CRR073318	Tawny withering 1	2.161
	CRR073319	Tawny withering 2	2.675
	CRR073320	Tawny withering 3	4.565