Gene detail

Detail information of GWHGAAZE011652

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KHG26345.1	1.86854E-87	Actin-depolymerizing factor [Gossypium arboreum]
Swissprot	tr\|Q2QLT8\|ADF11_ORYSJ	9E-81	Actin-depolymerizing factor 11
trEMBL	tr\|A0A061EMY3\|A0A061EMY3_THECC	7E-87	Actin depolymerizing factor 6 {ECO:0000313\|EMBL:EOY06038.1}
TAIR10	AT2G31200.1	6E-54	actin depolymerizing factor 6

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	69574842	69576855	+
GWHAAZE00000003	mRNA	69574842	69576855	+
GWHAAZE00000003	exon	69574842	69575161	+
GWHAAZE00000003	exon	69576705	69576855	+
GWHAAZE00000003	CDS	69574842	69575161	+
GWHAAZE00000003	CDS	69576705	69576855	+

Transcript Sequence
>GWHTAAZE011664 ATGAAAATGGGCTTTGGTTTAGAACAGGCAATTGAATTTTGGTTTAAATTGCAGACAAATGCATCATCTGGCATGGGTGTTGCTGAGCAGAGCAAAAACACATATCTGGAATTGCAGAGGAAGAAGGTGCACCGTTACGTGATTTTTAAGATTGATGAGAAGAAAAAGGAGGTTGTCGTTGATAAGACTGGAGGTCCAGCTGAGAGCTATGATGACTTCATTGAGTCTCTCCCTGAGAACGATTGCCGATATGCAGTCTATGACTTCGATTTTGTGACTGCTGAGAACTGCCAAAAGAGCAAAATCTTCTTCGTTTCTTGGTCTCCTGCAGTGTCTCGGATCCGTGCCAAAATGCTGTATGCCACATCCAAGGACAGGTTCAGAAGGGAGTTACAGGGCATCCACTACGAGATTCAGGCCACCGACCCCACCGAGATGGATCTTGAAATCATAAAAGAACGTGCTCACTAA

Network for GWHGAAZE011652

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00241.21	Cofilin_ADF	33	154	6.00E-38

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K05765	CFL	Regulation of actin cytoskeleton	map04810
		Fc gamma R-mediated phagocytosis	map04666
		Axon guidance	map04360

Gene Ontology

GO term	Ontology	Name
GO:0030042	biological_process	actin filament depolymerization
GO:0015629	cellular_component	actin cytoskeleton
GO:0003779	molecular_function	actin binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	67.067
	SRR3591706	second leaf	21.204
	SRR3591707	mature leaf	8.510
	SRR3591708	Shoot apex	44.848
	SRR3591709	Stem	124.639
	SRR3591710	White floral bud	12.461
	SRR3591711	White flower	9.428
	SRR3591712	Green floral bud	33.808
	SRR3591713	Yellow flower	10.350
SRP173429	SRR8316895	Juvenile bud stage	32.288
	SRR8316896	Juvenile bud stage	43.486
	SRR8316897	Juvenile bud stage	21.176
	SRR8316894	Third green stage	21.170
	SRR8316900	Third green stage	70.831
	SRR8316901	Third green stage	59.650
	SRR8316898	Complete white stage	13.008
	SRR8316899	Complete white stage	45.918
	SRR8316903	Complete white stage	19.617
	SRR8316902	Silver flowering stage	7.577
	SRR8316904	Silver flowering stage	7.853
	SRR8316905	Silver flowering stage	5.248
	SRR8316906	Gold flowering stage	10.619
	SRR8316907	Gold flowering stage	9.952
	SRR8316908	Gold flowering stage	7.256
SRP132670	SRR6706286	Control	44.056
	SRR6706287	Light intensity 50%	37.761
	SRR6706288	Light intensity 20%	40.283
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	51.877
	CNS0095593	Slightly white alabastrum(diploid) 2	70.329
	CNS0095594	Slightly white alabastrum(diploid) 3	55.163
	CNS0095595	Whole white alabastrum(diploid) 2	45.085
	CNS0095596	Whole white alabastrum(diploid) 3	47.780
	CNS0095597	Whole white alabastrum(diploid) 4	36.491
	CNS0095598	Silvery flower (diploied) 1	29.496
	CNS0095599	Silvery flower (diploied) 2	34.199
	CNS0095600	Silvery flower (diploied) 3	24.615
	CNS0095601	Golden flower (diploid) 1	29.930
	CNS0095602	Golden flower (diploid) 2	40.250
	CNS0095603	Golden flower (diploid) 3	33.678
	CNS0095604	Slightly white alabastrum(tetraploid) 1	33.443
	CNS0095605	Slightly white alabastrum(tetraploid) 2	34.815
	CNS0095606	Slightly white alabastrum(tetraploid) 3	55.895
	CNS0095607	Whole white alabastrum(tetraploid) 1	18.763
	CNS0095608	Whole white alabastrum(tetraploid) 2	14.543
	CNS0095609	Whole white alabastrum(tetraploid) 3	27.448
	CNS0095610	Silvery flower (tetraploid) 1	11.746
	CNS0095611	Silvery flower (tetraploid) 2	18.165
	CNS0095612	Silvery flower (tetraploid) 3	10.644
	CNS0095613	Golden flower (tetraploid) 1	14.206
	CNS0095614	Golden flower (tetraploid) 2	10.108
	CNS0095615	Golden flower (tetraploid) 3	5.057
CRA001975	CRR073297	Stem 1	68.831
	CRR073298	Stem 2	80.387
	CRR073299	Stem 3	94.619
	CRR073300	Leaf 1	65.490
	CRR073301	Leaf 2	73.481
	CRR073302	Leaf 3	100.745
	CRR073303	Juvenile bud 1	59.387
	CRR073304	Juvenile bud 2	33.122
	CRR073305	Juvenile bud 3	52.870
	CRR073306	Third green 1	3.354
	CRR073307	Third green 2	7.151
	CRR073308	Third green 3	6.549
	CRR073309	Second white 1	3.434
	CRR073310	Second white 2	1.285
	CRR073311	Second white 3	2.688
	CRR073312	Silver flowering 1	0.917
	CRR073313	Silver flowering 2	1.261
	CRR073314	Silver flowering 3	1.366
	CRR073315	Gold flowering 1	8.502
	CRR073316	Gold flowering 2	10.290
	CRR073317	Gold flowering 3	12.677
	CRR073318	Tawny withering 1	71.017
	CRR073319	Tawny withering 2	59.539
	CRR073320	Tawny withering 3	112.265