Gene detail

Detail information of GWHGAAZE011307

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009591684.1	2.68331E-91	PREDICTED: probable pectinesterase 53 [Nicotiana tomentosiformis]
Swissprot	tr\|Q8VYZ3\|PME53_ARATH	2E-75	Probable pectinesterase 53 (Precursor)
trEMBL	tr\|A0A061GML5\|A0A061GML5_THECC	3E-91	Pectinesterase {ECO:0000256\|RuleBase:RU000589} (Fragment)
TAIR10	AT5G19730.1	2E-62	Pectin lyase-like superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	56571418	56572863	+
GWHAAZE00000003	mRNA	56571418	56572863	+
GWHAAZE00000003	exon	56571418	56571728	+
GWHAAZE00000003	exon	56572378	56572567	+
GWHAAZE00000003	exon	56572789	56572863	+
GWHAAZE00000003	CDS	56571418	56571728	+
GWHAAZE00000003	CDS	56572378	56572567	+
GWHAAZE00000003	CDS	56572789	56572863	+

Transcript Sequence
>GWHTAAZE011319 ATCTATTCGAGCCATACACTATCCCACACAGAATCTATTAGACCCAAGAAAAATTCATGGAAACAATTAACCAAAAATGTGACACAAACCCAATACTCAGAACAACAATTCATGAAGTGGGTCAAATTTATTGGCACAGTTAAACAATCCCTTTTTAACACAACCAATAACAAGCTTTTTCCTTCTTATACTCTCACTGTCGATAAGAATCCGGACACCGGAGACTTCACGTCGATTCAAGATGCAATTGATTCTCTCTTTTTTATAAATCTTGTGAGAGTTGTGATTCAAGTTCATGCTGGTGTTTATGAGGAGAAGGTAAACATACCACTGTTGAAATCATTGATAACAATAGATGGAGAAGGAGTAGAGAAGATAGTGGTTCAATGGGGAGATACAGCTCAAACAATTGGGCCAAATGGGAAGCCTCTTGGTACCTTTGGTTCTGCTATTTTTGCTGTCAATTCCCCGTATCTCATAGCCAAGAACATCACGCTCAAGAACACAATGCCGGTACCAAAACCCGGAGCTATAGGAAAGCAAGCAGTGGCATTTAGGATACAGGTGATAATGTAG

Network for GWHGAAZE011307

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01095.20	Pectinesterase	72	188	5.70E-16

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01051	E3.1.1.11	Metabolic pathways	map01100
		Pentose and glucuronate interconversions	map00040
		Two-component system	map02020

Gene Ontology

GO term	Ontology	Name
GO:0042545	biological_process	cell wall modification
GO:0030599	molecular_function	pectinesterase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.145
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	3.929
	SRR8316896	Juvenile bud stage	3.801
	SRR8316897	Juvenile bud stage	4.663
	SRR8316894	Third green stage	3.597
	SRR8316900	Third green stage	10.012
	SRR8316901	Third green stage	7.394
	SRR8316898	Complete white stage	1.756
	SRR8316899	Complete white stage	11.502
	SRR8316903	Complete white stage	4.092
	SRR8316902	Silver flowering stage	1.709
	SRR8316904	Silver flowering stage	2.250
	SRR8316905	Silver flowering stage	1.260
	SRR8316906	Gold flowering stage	4.568
	SRR8316907	Gold flowering stage	4.182
	SRR8316908	Gold flowering stage	8.326
SRP132670	SRR6706286	Control	4.971
	SRR6706287	Light intensity 50%	6.766
	SRR6706288	Light intensity 20%	7.323
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	6.241
	CNS0095593	Slightly white alabastrum(diploid) 2	7.989
	CNS0095594	Slightly white alabastrum(diploid) 3	7.392
	CNS0095595	Whole white alabastrum(diploid) 2	6.714
	CNS0095596	Whole white alabastrum(diploid) 3	7.078
	CNS0095597	Whole white alabastrum(diploid) 4	4.593
	CNS0095598	Silvery flower (diploied) 1	3.563
	CNS0095599	Silvery flower (diploied) 2	2.954
	CNS0095600	Silvery flower (diploied) 3	3.950
	CNS0095601	Golden flower (diploid) 1	4.692
	CNS0095602	Golden flower (diploid) 2	3.185
	CNS0095603	Golden flower (diploid) 3	3.908
	CNS0095604	Slightly white alabastrum(tetraploid) 1	14.442
	CNS0095605	Slightly white alabastrum(tetraploid) 2	11.991
	CNS0095606	Slightly white alabastrum(tetraploid) 3	19.270
	CNS0095607	Whole white alabastrum(tetraploid) 1	12.531
	CNS0095608	Whole white alabastrum(tetraploid) 2	9.615
	CNS0095609	Whole white alabastrum(tetraploid) 3	17.554
	CNS0095610	Silvery flower (tetraploid) 1	6.492
	CNS0095611	Silvery flower (tetraploid) 2	6.070
	CNS0095612	Silvery flower (tetraploid) 3	7.069
	CNS0095613	Golden flower (tetraploid) 1	4.377
	CNS0095614	Golden flower (tetraploid) 2	6.988
	CNS0095615	Golden flower (tetraploid) 3	2.969
CRA001975	CRR073297	Stem 1	6.640
	CRR073298	Stem 2	5.678
	CRR073299	Stem 3	6.047
	CRR073300	Leaf 1	8.103
	CRR073301	Leaf 2	7.272
	CRR073302	Leaf 3	8.050
	CRR073303	Juvenile bud 1	3.320
	CRR073304	Juvenile bud 2	4.492
	CRR073305	Juvenile bud 3	4.973
	CRR073306	Third green 1	0.530
	CRR073307	Third green 2	1.810
	CRR073308	Third green 3	1.349
	CRR073309	Second white 1	2.446
	CRR073310	Second white 2	1.575
	CRR073311	Second white 3	1.128
	CRR073312	Silver flowering 1	0.940
	CRR073313	Silver flowering 2	0.079
	CRR073314	Silver flowering 3	0.281
	CRR073315	Gold flowering 1	0.527
	CRR073316	Gold flowering 2	1.091
	CRR073317	Gold flowering 3	0.856
	CRR073318	Tawny withering 1	2.408
	CRR073319	Tawny withering 2	2.000
	CRR073320	Tawny withering 3	3.815