Gene detail

Detail information of GWHGAAZE010620

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CAA87074.1	8.58711E-54	pathogenesis-related protein, PR-3 type [Sambucus nigra]
Swissprot	tr\|Q6K8R2\|CHI6_ORYSJ	2E-45	Chitinase 6 (Precursor)
trEMBL	tr\|Q43151\|Q43151_SAMNI	3E-54	Pathogenesis-related protein, PR-3 type {ECO:0000313\|EMBL:CAA87074.1} (Fragment)
TAIR10	AT3G54420.1	2E-38	homolog of carrot EP3-3 chitinase

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	15757516	15757902	-
GWHAAZE00000003	mRNA	15757516	15757902	-
GWHAAZE00000003	exon	15757516	15757902	-
GWHAAZE00000003	CDS	15757516	15757902	-

Transcript Sequence
>GWHTAAZE010632 ATGGTCCATCAAGGGACTATTGCGACGAAGAAAACACACAGTATCCATGTGCACCAAACAAGGGCTATTACGGCCGCGGTCCGATTCAACTCGTGGAATTTCAATTACGGTCCAGCCGGAATTAGCATTGGCTTTGACGGACTAAACAACCCTGAAATTGTTGCATCTGATCCGGTTGTGTCATTCCGGACTGCGTTGTGGTATTGGATGACCGAAGTTCACTCTCTCTTTACTTCTGGCCAAGGATTTGGGGCCACCATCCGTGCCATTAACGGCCAACTTGAGTGCGATGGCGCAAACCCAAATACTGTCACTGCCCGTGTTCAGTATTACACCGAATATTGTAATCAACTTGGTGTTTCTCCTGGAGATAATCTTCGATGCTAG

Network for GWHGAAZE010620

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00182.20	Glyco_hydro_19	31	73	4.00E-15
PF00182.20	Glyco_hydro_19	81	128	1.50E-09

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01183	E3.2.1.14	Metabolic pathways	map01100
K01183	E3.2.1.14	Amino sugar and nucleotide sugar metabolism	map00520

Gene Ontology

GO term	Ontology	Name
GO:0006032	biological_process	chitin catabolic process
GO:0016998	biological_process	cell wall macromolecule catabolic process
GO:0004568	molecular_function	chitinase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.594
	SRR3591710	White floral bud	1.312
	SRR3591711	White flower	3.514
	SRR3591712	Green floral bud	0.270
	SRR3591713	Yellow flower	28.451
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.477
	SRR8316897	Juvenile bud stage	1.581
	SRR8316894	Third green stage	0.256
	SRR8316900	Third green stage	0.397
	SRR8316901	Third green stage	0.569
	SRR8316898	Complete white stage	3.317
	SRR8316899	Complete white stage	1.633
	SRR8316903	Complete white stage	1.910
	SRR8316902	Silver flowering stage	14.757
	SRR8316904	Silver flowering stage	14.711
	SRR8316905	Silver flowering stage	7.872
	SRR8316906	Gold flowering stage	94.841
	SRR8316907	Gold flowering stage	37.865
	SRR8316908	Gold flowering stage	67.559
SRP132670	SRR6706286	Control	1.244
	SRR6706287	Light intensity 50%	0.774
	SRR6706288	Light intensity 20%	0.362
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.482
	CNS0095593	Slightly white alabastrum(diploid) 2	1.120
	CNS0095594	Slightly white alabastrum(diploid) 3	0.177
	CNS0095595	Whole white alabastrum(diploid) 2	0.463
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.253
	CNS0095598	Silvery flower (diploied) 1	2.530
	CNS0095599	Silvery flower (diploied) 2	0.783
	CNS0095600	Silvery flower (diploied) 3	9.687
	CNS0095601	Golden flower (diploid) 1	4.186
	CNS0095602	Golden flower (diploid) 2	17.689
	CNS0095603	Golden flower (diploid) 3	16.416
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.045
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.541
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.133
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.135
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.279
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	5.857
	CNS0095611	Silvery flower (tetraploid) 2	0.386
	CNS0095612	Silvery flower (tetraploid) 3	2.462
	CNS0095613	Golden flower (tetraploid) 1	16.893
	CNS0095614	Golden flower (tetraploid) 2	21.383
	CNS0095615	Golden flower (tetraploid) 3	2.412
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.196
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.141
	CRR073301	Leaf 2	0.216
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.110
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.112
	CRR073307	Third green 2	0.062
	CRR073308	Third green 3	0.897
	CRR073309	Second white 1	7.534
	CRR073310	Second white 2	10.535
	CRR073311	Second white 3	5.123
	CRR073312	Silver flowering 1	34.217
	CRR073313	Silver flowering 2	38.280
	CRR073314	Silver flowering 3	34.595
	CRR073315	Gold flowering 1	0.041
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.396
	CRR073318	Tawny withering 1	11.101
	CRR073319	Tawny withering 2	26.747
	CRR073320	Tawny withering 3	0.204