Gene detail

Detail information of GWHGAAZE010204

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ADD31166.1	8.14289E-65	RNA polymerase beta' subunit protein (chloroplast) [Lonicera japonica]
Swissprot	tr\|B1NWE1\|RPOC1_MANES	4E-65	DNA-directed RNA polymerase subunit beta' {ECO:0000255\|HAMAP-Rule:MF_01323}
trEMBL	tr\|K7P8R9\|K7P8R9_9GENT	3E-63	DNA-directed RNA polymerase {ECO:0000256\|RuleBase:RU004279} (Fragment)
TAIR10	ATCG00180.1	5E-55	DNA-directed RNA polymerase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	124026438	124026788	-
GWHAAZE00000002	mRNA	124026438	124026788	-
GWHAAZE00000002	exon	124026438	124026788	-
GWHAAZE00000002	CDS	124026438	124026788	-

Transcript Sequence
>GWHTAAZE010216 ATGGGAAATACTTCAGGAAGTTATGCAGGGCATCCGGTATTGCTGAATAGAGCGCCCACTCTGCATAGATTAGGCATACAAGCATTTCAGCCCGTTTTAGTGGAAGGGCGTGCTATTTGTTTACATCCGTTAGTTTGTAAAGGATTCAATGCAGACTTTGACGGGGATCAAATGGCTGTTCATGTGCCTTTATCTTTAGAGGCTCAAGCAGAGGCACGTTTACTTATGTTTTCTCATCTGAATCTTTTGTCTCCAGCTATTGGGAATCCCATTTCCGTACCAACCCAAGATATGCTTATTGGACTCTATGTCTTAACGAGGGGGGAATCGTCGAGGTGTTTGTGTAAATAG

Network for GWHGAAZE010204

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00623.21	RNA_pol_Rpb1_2	10	76	4.80E-26

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03046	rpoC	RNA polymerase	map03020

Gene Ontology

GO term	Ontology	Name
GO:0006351	biological_process	transcription, DNA-templated
GO:0003677	molecular_function	DNA binding
GO:0003899	molecular_function	DNA-directed 5'-3' RNA polymerase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.135
	SRR3591706	second leaf	0.208
	SRR3591707	mature leaf	0.118
	SRR3591708	Shoot apex	0.538
	SRR3591709	Stem	0.047
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.203
	SRR3591713	Yellow flower	0.171
SRP173429	SRR8316895	Juvenile bud stage	1.212
	SRR8316896	Juvenile bud stage	0.305
	SRR8316897	Juvenile bud stage	0.908
	SRR8316894	Third green stage	1.816
	SRR8316900	Third green stage	0.389
	SRR8316901	Third green stage	0.220
	SRR8316898	Complete white stage	0.682
	SRR8316899	Complete white stage	0.061
	SRR8316903	Complete white stage	0.633
	SRR8316902	Silver flowering stage	0.714
	SRR8316904	Silver flowering stage	0.409
	SRR8316905	Silver flowering stage	0.635
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.007
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.121
	SRR6706287	Light intensity 50%	0.050
	SRR6706288	Light intensity 20%	0.033
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.141
	CNS0095593	Slightly white alabastrum(diploid) 2	0.235
	CNS0095594	Slightly white alabastrum(diploid) 3	0.363
	CNS0095595	Whole white alabastrum(diploid) 2	0.663
	CNS0095596	Whole white alabastrum(diploid) 3	0.697
	CNS0095597	Whole white alabastrum(diploid) 4	0.459
	CNS0095598	Silvery flower (diploied) 1	0.086
	CNS0095599	Silvery flower (diploied) 2	0.186
	CNS0095600	Silvery flower (diploied) 3	0.492
	CNS0095601	Golden flower (diploid) 1	0.304
	CNS0095602	Golden flower (diploid) 2	0.167
	CNS0095603	Golden flower (diploid) 3	0.208
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.213
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.113
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.130
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.035
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.262
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.262
	CNS0095610	Silvery flower (tetraploid) 1	0.652
	CNS0095611	Silvery flower (tetraploid) 2	0.219
	CNS0095612	Silvery flower (tetraploid) 3	0.085
	CNS0095613	Golden flower (tetraploid) 1	0.511
	CNS0095614	Golden flower (tetraploid) 2	0.497
	CNS0095615	Golden flower (tetraploid) 3	0.118
CRA001975	CRR073297	Stem 1	0.392
	CRR073298	Stem 2	0.352
	CRR073299	Stem 3	0.207
	CRR073300	Leaf 1	0.417
	CRR073301	Leaf 2	0.347
	CRR073302	Leaf 3	0.659
	CRR073303	Juvenile bud 1	0.488
	CRR073304	Juvenile bud 2	0.467
	CRR073305	Juvenile bud 3	1.061
	CRR073306	Third green 1	0.696
	CRR073307	Third green 2	0.148
	CRR073308	Third green 3	0.540
	CRR073309	Second white 1	0.889
	CRR073310	Second white 2	1.062
	CRR073311	Second white 3	1.945
	CRR073312	Silver flowering 1	1.673
	CRR073313	Silver flowering 2	0.143
	CRR073314	Silver flowering 3	0.449
	CRR073315	Gold flowering 1	1.161
	CRR073316	Gold flowering 2	0.623
	CRR073317	Gold flowering 3	1.390
	CRR073318	Tawny withering 1	0.277
	CRR073319	Tawny withering 2	0.050
	CRR073320	Tawny withering 3	0.388