Gene detail

Detail information of GWHGAAZE010151

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ADD31545.1	4.0761E-136	ATP synthase CF0 subunit IV protein (chloroplast) [Lonicera japonica]
Swissprot	tr\|Q68S18\|ATPI_PANGI	5E-136	ATP synthase subunit a, chloroplastic {ECO:0000255\|HAMAP-Rule:MF_01393}
trEMBL	tr\|D3WBN1\|D3WBN1_LONJA	2E-136	ATP synthase subunit a, chloroplastic {ECO:0000256\|HAMAP-Rule:MF_01393, ECO:0000256\|RuleBase:RU004449}
TAIR10	ATCG00150.1	6E-93	ATPase, F0 complex, subunit A protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	123813245	123814855	+
GWHAAZE00000002	mRNA	123813245	123814855	+
GWHAAZE00000002	exon	123813245	123813329	+
GWHAAZE00000002	exon	123814266	123814855	+
GWHAAZE00000002	CDS	123813245	123813329	+
GWHAAZE00000002	CDS	123814266	123814855	+

Transcript Sequence
>GWHTAAZE010163 ATGATGGAGGCAGGAGTTCATTTTGGCCATGGTATTAGGAAATGGAATCCTAAAATGGCACCTTATATTTCTGCAAAGCGTAAAGGTTCAGCCACTATAGCTGTTCGGAACCCACAAACCATTCCGACCGGCAGTCAGAATTTCTTCGAATATGTCCTTGAATTCATTCGAGATGTGAGTAAAACTCAAATTGGAGAAGAATATGGTCCTTGGGTTCCTTTTATTGGAACTATGTTTCTATTTATTTTTGTTTCTAATTGGTCAGGAGCTCTTTTGCCTTGGAAAATCATACAATTACCTCACGGGGAGTTAGCCGCACCCACGAATGATATAAATACTACTGTTGCTTTAGCTCTACTCACGTCAGTGGCATATTTCTATGCGGGTCTTAGCAAAAGGGGATTGGGTTATTTTGGGAAATATATTCAACCAACTCCAATCCTTTTACCTATTAACATATTAGAAGATTTCACAAAGCCTTTATCACTCAGTTTTCGACTTTTCGGAAATATATTAGCTGATGAATTGGTAGTTGTTGTTCTTGTTTCTTTAGTACCTTCAGTGGTTCCTATACCTGTCATGTTCCTTGGATTATTTACAAGTGGTATTCAAGCTCTTATTTTTGCAACTTTAGCCGCGGCTTATATAGGTGAATCCATGGAGGGTCATCATTGA

Network for GWHGAAZE010151

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00318.21	Ribosomal_S2	1	40	9.10E-10
PF00119.21	ATP-synt_A	34	216	4.60E-49

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02108	ATPF0A, atpB	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Photosynthesis	map00195

Gene Ontology

GO term	Ontology	Name
GO:0015986	biological_process	ATP synthesis coupled proton transport
GO:0006412	biological_process	translation
GO:0045263	cellular_component	proton-transporting ATP synthase complex, coupling factor F(o)
GO:0005840	cellular_component	ribosome
GO:0015078	molecular_function	proton transmembrane transporter activity
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.767
	SRR3591706	second leaf	0.890
	SRR3591707	mature leaf	1.872
	SRR3591708	Shoot apex	1.244
	SRR3591709	Stem	0.635
	SRR3591710	White floral bud	0.189
	SRR3591711	White flower	0.282
	SRR3591712	Green floral bud	0.601
	SRR3591713	Yellow flower	0.107
SRP173429	SRR8316895	Juvenile bud stage	3.146
	SRR8316896	Juvenile bud stage	2.000
	SRR8316897	Juvenile bud stage	5.115
	SRR8316894	Third green stage	4.874
	SRR8316900	Third green stage	1.667
	SRR8316901	Third green stage	0.706
	SRR8316898	Complete white stage	1.384
	SRR8316899	Complete white stage	0.750
	SRR8316903	Complete white stage	1.405
	SRR8316902	Silver flowering stage	1.996
	SRR8316904	Silver flowering stage	2.570
	SRR8316905	Silver flowering stage	1.732
	SRR8316906	Gold flowering stage	0.486
	SRR8316907	Gold flowering stage	0.232
	SRR8316908	Gold flowering stage	0.344
SRP132670	SRR6706286	Control	0.207
	SRR6706287	Light intensity 50%	0.364
	SRR6706288	Light intensity 20%	0.252
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.502
	CNS0095593	Slightly white alabastrum(diploid) 2	1.304
	CNS0095594	Slightly white alabastrum(diploid) 3	1.946
	CNS0095595	Whole white alabastrum(diploid) 2	3.545
	CNS0095596	Whole white alabastrum(diploid) 3	2.364
	CNS0095597	Whole white alabastrum(diploid) 4	3.116
	CNS0095598	Silvery flower (diploied) 1	2.318
	CNS0095599	Silvery flower (diploied) 2	1.650
	CNS0095600	Silvery flower (diploied) 3	1.706
	CNS0095601	Golden flower (diploid) 1	0.943
	CNS0095602	Golden flower (diploid) 2	0.833
	CNS0095603	Golden flower (diploid) 3	1.456
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.824
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.977
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.009
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.193
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.505
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.128
	CNS0095610	Silvery flower (tetraploid) 1	1.499
	CNS0095611	Silvery flower (tetraploid) 2	1.656
	CNS0095612	Silvery flower (tetraploid) 3	1.225
	CNS0095613	Golden flower (tetraploid) 1	1.339
	CNS0095614	Golden flower (tetraploid) 2	1.621
	CNS0095615	Golden flower (tetraploid) 3	1.198
CRA001975	CRR073297	Stem 1	0.396
	CRR073298	Stem 2	1.462
	CRR073299	Stem 3	0.434
	CRR073300	Leaf 1	0.439
	CRR073301	Leaf 2	0.722
	CRR073302	Leaf 3	0.191
	CRR073303	Juvenile bud 1	0.983
	CRR073304	Juvenile bud 2	0.591
	CRR073305	Juvenile bud 3	1.127
	CRR073306	Third green 1	1.122
	CRR073307	Third green 2	0.236
	CRR073308	Third green 3	0.308
	CRR073309	Second white 1	0.424
	CRR073310	Second white 2	1.964
	CRR073311	Second white 3	2.946
	CRR073312	Silver flowering 1	0.832
	CRR073313	Silver flowering 2	0.497
	CRR073314	Silver flowering 3	0.918
	CRR073315	Gold flowering 1	8.815
	CRR073316	Gold flowering 2	5.633
	CRR073317	Gold flowering 3	10.523
	CRR073318	Tawny withering 1	0.430
	CRR073319	Tawny withering 2	0.914
	CRR073320	Tawny withering 3	0.429