Gene detail

Detail information of GWHGAAZE010144

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ADD31241.1	3.86516E-34	NADH-plastoquinone oxidoreductase subunit K protein (chloroplast) [Lonicera japonica]
Swissprot	tr\|A8Y9H4\|NDHK_LOLPR	9E-36	NAD(P)H-quinone oxidoreductase subunit K, chloroplastic {ECO:0000255\|HAMAP-Rule:MF_01356}
trEMBL	tr\|D3WBP7\|D3WBP7_LONJA	1E-34	NAD(P)H-quinone oxidoreductase subunit K, chloroplastic {ECO:0000256\|HAMAP-Rule:MF_01356}
TAIR10	ATCG00430.1	2E-27	photosystem II reaction center protein G

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	123778865	123779197	+
GWHAAZE00000002	mRNA	123778865	123779197	+
GWHAAZE00000002	exon	123778865	123779197	+
GWHAAZE00000002	CDS	123778865	123779197	+

Transcript Sequence
>GWHTAAZE010156 ATGCCTGAACCAAAATATGTTATTGCTATGGGGCATGTACAATTACAGGGGATGTTCAGTACCGATTCTTATAGTACTGTTCGGGGAGTCGATAAGCTAATTCCGGTGGATGTCTATTTGCCGGGCTGTCCGCCTAAACCGGAAGCGGTTATCGATGCTATAACAAAACTTCGTAGAAAATATCTCGAGAAATCTATGAAGATAGAATGGGTATCAACAGGAAAATCGGTGTTTTACTACCAATCACAGTTTCAGGTTTGGCGTAGTAGTCATACTGGAATTATGATCAAGGATTCCTTTATCAAGTGCCACCTACTTCAGAGTCCCTCCTGA

Network for GWHGAAZE010144

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01058.23	Oxidored_q6	1	57	1.10E-10

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K05582	ndhK	Metabolic pathways	map01100
K05582	ndhK	Oxidative phosphorylation	map00190

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0051536	molecular_function	iron-sulfur cluster binding
GO:0008137	molecular_function	NADH dehydrogenase (ubiquinone) activity
GO:0048038	molecular_function	quinone binding
GO:0051539	molecular_function	4 iron, 4 sulfur cluster binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.042
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.087
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.047
SRP173429	SRR8316895	Juvenile bud stage	0.027
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.044
	SRR8316894	Third green stage	0.203
	SRR8316900	Third green stage	0.027
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.052
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.031
	SRR8316902	Silver flowering stage	0.022
	SRR8316904	Silver flowering stage	0.001
	SRR8316905	Silver flowering stage	0.021
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.124
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.000
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.093
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.133
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.001
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.211
	CRR073299	Stem 3	0.141
	CRR073300	Leaf 1	0.037
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.254
	CRR073306	Third green 1	0.159
	CRR073307	Third green 2	0.019
	CRR073308	Third green 3	0.018
	CRR073309	Second white 1	0.084
	CRR073310	Second white 2	0.726
	CRR073311	Second white 3	0.659
	CRR073312	Silver flowering 1	0.235
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.129
	CRR073315	Gold flowering 1	3.584
	CRR073316	Gold flowering 2	1.026
	CRR073317	Gold flowering 3	2.279
	CRR073318	Tawny withering 1	0.125
	CRR073319	Tawny withering 2	0.085
	CRR073320	Tawny withering 3	0.325