Gene detail

Detail information of GWHGAAZE010138

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ADD30323.1	2.65771E-80	ribosomal protein L16 (chloroplast) [Lonicera japonica]
Swissprot	tr\|Q332T9\|RK16_LACSA	1E-78	50S ribosomal protein L16, chloroplastic {ECO:0000255\|HAMAP-Rule:MF_01342}
trEMBL	tr\|D3WBS6\|D3WBS6_LONJA	1E-80	50S ribosomal protein L16, chloroplastic {ECO:0000256\|HAMAP-Rule:MF_01342, ECO:0000256\|RuleBase:RU004415}
TAIR10	ATCG00790.1	4E-50	ribosomal protein L16

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	123757201	123757560	-
GWHAAZE00000002	mRNA	123757201	123757560	-
GWHAAZE00000002	exon	123757201	123757560	-
GWHAAZE00000002	CDS	123757201	123757560	-

Transcript Sequence
>GWHTAAZE010150 ATGAAGGGAATATCTTATCGAGGTAATCACATTTGTTTCGGTAAATATGCTCTTCAGGCACTTGAACCCACTTGGATCACATCGAGACAAATAGAAGCAGGTCGACGAGCAATGACACGAAATGCACGTCGTGGTGGAAAAATATGGGTACGTATATTTCCAGACAAACCGGTTACAGTAAGATCCGCAGAAACACGTATGGGTTCGGGGAAAGGATCCCCCGAATATTGGGTAGCTGTTGTTAAACCGGGCCGCATCCTTTATGAAATGGGTGGAGTAACAGAAAATATAGCCAGAAAGGCTATTTCGATAGCAGCGTCCAAAATGCCTATACGGGCTCAATTCATTATTGCGGGATAA

Network for GWHGAAZE010138

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00252.19	Ribosomal_L16	2	116	2.30E-43

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02878	RP-L16, MRPL16, rplP	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome
GO:0019843	molecular_function	rRNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	6.081
	SRR3591706	second leaf	3.586
	SRR3591707	mature leaf	5.558
	SRR3591708	Shoot apex	6.799
	SRR3591709	Stem	3.487
	SRR3591710	White floral bud	2.884
	SRR3591711	White flower	1.974
	SRR3591712	Green floral bud	4.082
	SRR3591713	Yellow flower	2.386
SRP173429	SRR8316895	Juvenile bud stage	31.684
	SRR8316896	Juvenile bud stage	19.584
	SRR8316897	Juvenile bud stage	44.158
	SRR8316894	Third green stage	46.808
	SRR8316900	Third green stage	14.602
	SRR8316901	Third green stage	9.860
	SRR8316898	Complete white stage	9.281
	SRR8316899	Complete white stage	6.316
	SRR8316903	Complete white stage	9.870
	SRR8316902	Silver flowering stage	13.750
	SRR8316904	Silver flowering stage	17.875
	SRR8316905	Silver flowering stage	17.573
	SRR8316906	Gold flowering stage	6.753
	SRR8316907	Gold flowering stage	9.017
	SRR8316908	Gold flowering stage	8.717
SRP132670	SRR6706286	Control	11.802
	SRR6706287	Light intensity 50%	14.767
	SRR6706288	Light intensity 20%	12.506
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	52.727
	CNS0095593	Slightly white alabastrum(diploid) 2	43.320
	CNS0095594	Slightly white alabastrum(diploid) 3	61.393
	CNS0095595	Whole white alabastrum(diploid) 2	61.584
	CNS0095596	Whole white alabastrum(diploid) 3	53.529
	CNS0095597	Whole white alabastrum(diploid) 4	54.502
	CNS0095598	Silvery flower (diploied) 1	39.774
	CNS0095599	Silvery flower (diploied) 2	36.612
	CNS0095600	Silvery flower (diploied) 3	24.339
	CNS0095601	Golden flower (diploid) 1	35.392
	CNS0095602	Golden flower (diploid) 2	21.628
	CNS0095603	Golden flower (diploid) 3	25.865
	CNS0095604	Slightly white alabastrum(tetraploid) 1	42.048
	CNS0095605	Slightly white alabastrum(tetraploid) 2	45.979
	CNS0095606	Slightly white alabastrum(tetraploid) 3	30.269
	CNS0095607	Whole white alabastrum(tetraploid) 1	33.675
	CNS0095608	Whole white alabastrum(tetraploid) 2	43.130
	CNS0095609	Whole white alabastrum(tetraploid) 3	25.488
	CNS0095610	Silvery flower (tetraploid) 1	20.863
	CNS0095611	Silvery flower (tetraploid) 2	34.849
	CNS0095612	Silvery flower (tetraploid) 3	19.075
	CNS0095613	Golden flower (tetraploid) 1	17.476
	CNS0095614	Golden flower (tetraploid) 2	17.883
	CNS0095615	Golden flower (tetraploid) 3	27.400
CRA001975	CRR073297	Stem 1	134.637
	CRR073298	Stem 2	159.470
	CRR073299	Stem 3	81.539
	CRR073300	Leaf 1	115.362
	CRR073301	Leaf 2	108.770
	CRR073302	Leaf 3	84.196
	CRR073303	Juvenile bud 1	105.027
	CRR073304	Juvenile bud 2	70.114
	CRR073305	Juvenile bud 3	72.318
	CRR073306	Third green 1	67.249
	CRR073307	Third green 2	36.686
	CRR073308	Third green 3	73.597
	CRR073309	Second white 1	26.329
	CRR073310	Second white 2	55.849
	CRR073311	Second white 3	61.536
	CRR073312	Silver flowering 1	30.096
	CRR073313	Silver flowering 2	7.637
	CRR073314	Silver flowering 3	29.395
	CRR073315	Gold flowering 1	234.255
	CRR073316	Gold flowering 2	268.944
	CRR073317	Gold flowering 3	79.728
	CRR073318	Tawny withering 1	65.948
	CRR073319	Tawny withering 2	47.365
	CRR073320	Tawny withering 3	45.715