Gene detail

Detail information of GWHGAAZE010132

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ADD31105.1	8.8198E-157	clp protease proteolytic subunit protein (chloroplast) [Lonicera japonica]
Swissprot	tr\|P12210\|CLPP_TOBAC	1E-77	ATP-dependent Clp protease proteolytic subunit {ECO:0000255\|HAMAP-Rule:MF_00444}
trEMBL	tr\|D3WBN4\|D3WBN4_LONJA	3E-157	ATP-dependent Clp protease proteolytic subunit {ECO:0000256\|RuleBase:RU003567}
TAIR10	ATCG00670.1	2E-53	plastid-encoded CLP P

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	123747202	123747852	-
GWHAAZE00000002	mRNA	123747202	123747852	-
GWHAAZE00000002	exon	123747202	123747852	-
GWHAAZE00000002	CDS	123747202	123747852	-

Transcript Sequence
>GWHTAAZE010144 ATGCCTGTAGGTGTTCCAAAAATACCCTTTCAAATTTCTGGAGACGAAGAAGCGTCTTGGGTTGACGTATACAACGGACTTTATCGAAGGGGATTCCTTTTTATAGTCCAAGAGATTGATACCGAACTCTCAAATCAAATTGTAGGTCTTATGGTATTTCTCAGTTTGGAGGGTGAGGTAAACGATCTGTATTTCTTTATATCCTCTCTCGGCGGATCCATGGTAGATGGATTCGCTATTTTTGATATGCTGGTATATTTGCCACCAACGATGCATACATTGAGTATCGGAGAATGCGCCTCAATGGCATCTTTGATCGTGGCCGGAGGAACATTTACCCAACGTATAGCATTCCCTCACAGTAGGATAATGATCCATCAACCTAATACTTTTCCTTTTGAGACACCAACGGGAGAAACTTTCCTCGAAATAAAGGAATTCTGTCGCCTGCGTGCGTTGGTCGGAGAGGCTTATGCAAAAATAACGGGCCAACCCCTTTGGGTTGTAGAGATAGACCTGGAAAGAGATATTTTTATGTCAGCACAAGAAGCCAAAGATTATGGAATTGTTGATCTTGTAGCGAGTGGCAAGCTTGAATTTCGTCAAAACCCGAGTGTGCGCAAGCGGCCATTTGAGATTTTCCCTTCTTAA

Network for GWHGAAZE010132

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00574.24	CLP_protease	17	194	2.80E-48

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01358	clpP, CLPP	Cell cycle - Caulobacter	map04112
K01358	clpP, CLPP	Longevity regulating pathway - worm	map04212

Gene Ontology

GO term	Ontology	Name
GO:0006508	biological_process	proteolysis
GO:0004252	molecular_function	serine-type endopeptidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.170
	SRR3591706	second leaf	1.107
	SRR3591707	mature leaf	1.583
	SRR3591708	Shoot apex	1.554
	SRR3591709	Stem	0.787
	SRR3591710	White floral bud	1.922
	SRR3591711	White flower	0.610
	SRR3591712	Green floral bud	0.777
	SRR3591713	Yellow flower	0.751
SRP173429	SRR8316895	Juvenile bud stage	7.392
	SRR8316896	Juvenile bud stage	4.261
	SRR8316897	Juvenile bud stage	11.575
	SRR8316894	Third green stage	12.571
	SRR8316900	Third green stage	1.600
	SRR8316901	Third green stage	1.237
	SRR8316898	Complete white stage	3.966
	SRR8316899	Complete white stage	0.561
	SRR8316903	Complete white stage	3.148
	SRR8316902	Silver flowering stage	6.209
	SRR8316904	Silver flowering stage	4.553
	SRR8316905	Silver flowering stage	5.387
	SRR8316906	Gold flowering stage	2.044
	SRR8316907	Gold flowering stage	0.934
	SRR8316908	Gold flowering stage	2.128
SRP132670	SRR6706286	Control	0.724
	SRR6706287	Light intensity 50%	0.894
	SRR6706288	Light intensity 20%	0.994
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.889
	CNS0095593	Slightly white alabastrum(diploid) 2	4.014
	CNS0095594	Slightly white alabastrum(diploid) 3	3.340
	CNS0095595	Whole white alabastrum(diploid) 2	6.210
	CNS0095596	Whole white alabastrum(diploid) 3	3.593
	CNS0095597	Whole white alabastrum(diploid) 4	4.136
	CNS0095598	Silvery flower (diploied) 1	4.846
	CNS0095599	Silvery flower (diploied) 2	3.471
	CNS0095600	Silvery flower (diploied) 3	2.282
	CNS0095601	Golden flower (diploid) 1	2.920
	CNS0095602	Golden flower (diploid) 2	1.580
	CNS0095603	Golden flower (diploid) 3	1.880
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.061
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.369
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.016
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.632
	CNS0095608	Whole white alabastrum(tetraploid) 2	4.911
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.374
	CNS0095610	Silvery flower (tetraploid) 1	1.929
	CNS0095611	Silvery flower (tetraploid) 2	1.315
	CNS0095612	Silvery flower (tetraploid) 3	1.714
	CNS0095613	Golden flower (tetraploid) 1	3.231
	CNS0095614	Golden flower (tetraploid) 2	1.793
	CNS0095615	Golden flower (tetraploid) 3	2.215
CRA001975	CRR073297	Stem 1	6.606
	CRR073298	Stem 2	8.701
	CRR073299	Stem 3	3.291
	CRR073300	Leaf 1	5.184
	CRR073301	Leaf 2	4.345
	CRR073302	Leaf 3	3.591
	CRR073303	Juvenile bud 1	7.736
	CRR073304	Juvenile bud 2	4.551
	CRR073305	Juvenile bud 3	10.251
	CRR073306	Third green 1	5.662
	CRR073307	Third green 2	4.179
	CRR073308	Third green 3	6.740
	CRR073309	Second white 1	4.940
	CRR073310	Second white 2	18.695
	CRR073311	Second white 3	28.470
	CRR073312	Silver flowering 1	28.294
	CRR073313	Silver flowering 2	7.618
	CRR073314	Silver flowering 3	9.645
	CRR073315	Gold flowering 1	24.501
	CRR073316	Gold flowering 2	19.059
	CRR073317	Gold flowering 3	17.004
	CRR073318	Tawny withering 1	3.972
	CRR073319	Tawny withering 2	4.788
	CRR073320	Tawny withering 3	3.582