Gene detail

Detail information of GWHGAAZE010131

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ADD30006.1	4.88749E-96	ribosomal protein S18 (chloroplast) [Lonicera japonica]
Swissprot	tr\|A8Y9A8\|RR18_LOLPR	1E-42	30S ribosomal protein S18, chloroplastic {ECO:0000255\|HAMAP-Rule:MF_00270}
trEMBL	tr\|D3WBU3\|D3WBU3_LONJA	2E-96	30S ribosomal protein S18, chloroplastic {ECO:0000256\|HAMAP-Rule:MF_00270}
TAIR10	ATCG00650.1	2E-26	ribosomal protein S18

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	123744915	123745373	+
GWHAAZE00000002	mRNA	123744915	123745373	+
GWHAAZE00000002	exon	123744915	123745373	+
GWHAAZE00000002	CDS	123744915	123745373	+

Transcript Sequence
>GWHTAAZE010143 ATGGATAAATCCAAGCGACCCTTTCTGAAATCCAAGCGACCCTTTCTGAAATCCAAGCGACCCTTTCGGAAATCCAAGCGACCCTTTCGGAAATCCAAGCGACCTTTTCGTAGGCGTTTACCCCCAATCCAACCGGGGGATCAAATTGAGTATAGAAACATGAGTTTAATTAGTCGATTTATTAGTGACCAAGGAAAAATATTACCTCGACGGGTGAAAAGATTAACCTTGAAACAACAACGATTAATTACTCTTGCTATAAAACAAGCTCGTATTTTATCTTCGTTACCCTTTCTTAATAATAGGAAACTGTTTAAGACGAAAGCGAAACCAATTAACAAAAAATTTAATAAGCGAAAGAAACGCCTTAAGAATAAATTTCATCCGAAAGATAAAAAAATTATCAATAAAGAGAAGTATTTGAAAAATCGATTCAAGAACAAAATGGAATCGCGTTAG

Network for GWHGAAZE010131

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01084.21	Ribosomal_S18	48	93	9.30E-17

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02963	RP-S18, MRPS18, rpsR	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.931
	SRR3591706	second leaf	7.266
	SRR3591707	mature leaf	21.487
	SRR3591708	Shoot apex	5.749
	SRR3591709	Stem	2.393
	SRR3591710	White floral bud	1.655
	SRR3591711	White flower	1.194
	SRR3591712	Green floral bud	3.252
	SRR3591713	Yellow flower	1.676
SRP173429	SRR8316895	Juvenile bud stage	32.365
	SRR8316896	Juvenile bud stage	20.843
	SRR8316897	Juvenile bud stage	32.992
	SRR8316894	Third green stage	35.942
	SRR8316900	Third green stage	23.159
	SRR8316901	Third green stage	14.343
	SRR8316898	Complete white stage	11.436
	SRR8316899	Complete white stage	9.643
	SRR8316903	Complete white stage	9.253
	SRR8316902	Silver flowering stage	14.357
	SRR8316904	Silver flowering stage	18.234
	SRR8316905	Silver flowering stage	14.376
	SRR8316906	Gold flowering stage	11.081
	SRR8316907	Gold flowering stage	11.284
	SRR8316908	Gold flowering stage	10.788
SRP132670	SRR6706286	Control	1.779
	SRR6706287	Light intensity 50%	2.256
	SRR6706288	Light intensity 20%	2.456
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	139.818
	CNS0095593	Slightly white alabastrum(diploid) 2	117.159
	CNS0095594	Slightly white alabastrum(diploid) 3	171.846
	CNS0095595	Whole white alabastrum(diploid) 2	135.264
	CNS0095596	Whole white alabastrum(diploid) 3	97.476
	CNS0095597	Whole white alabastrum(diploid) 4	129.410
	CNS0095598	Silvery flower (diploied) 1	57.377
	CNS0095599	Silvery flower (diploied) 2	54.191
	CNS0095600	Silvery flower (diploied) 3	15.232
	CNS0095601	Golden flower (diploid) 1	53.081
	CNS0095602	Golden flower (diploid) 2	12.514
	CNS0095603	Golden flower (diploid) 3	15.194
	CNS0095604	Slightly white alabastrum(tetraploid) 1	56.498
	CNS0095605	Slightly white alabastrum(tetraploid) 2	80.247
	CNS0095606	Slightly white alabastrum(tetraploid) 3	17.802
	CNS0095607	Whole white alabastrum(tetraploid) 1	63.448
	CNS0095608	Whole white alabastrum(tetraploid) 2	93.685
	CNS0095609	Whole white alabastrum(tetraploid) 3	16.675
	CNS0095610	Silvery flower (tetraploid) 1	8.678
	CNS0095611	Silvery flower (tetraploid) 2	13.998
	CNS0095612	Silvery flower (tetraploid) 3	6.921
	CNS0095613	Golden flower (tetraploid) 1	25.054
	CNS0095614	Golden flower (tetraploid) 2	10.029
	CNS0095615	Golden flower (tetraploid) 3	16.049
CRA001975	CRR073297	Stem 1	52.537
	CRR073298	Stem 2	79.035
	CRR073299	Stem 3	35.593
	CRR073300	Leaf 1	44.387
	CRR073301	Leaf 2	71.809
	CRR073302	Leaf 3	35.779
	CRR073303	Juvenile bud 1	47.034
	CRR073304	Juvenile bud 2	26.649
	CRR073305	Juvenile bud 3	27.794
	CRR073306	Third green 1	18.925
	CRR073307	Third green 2	19.207
	CRR073308	Third green 3	28.589
	CRR073309	Second white 1	12.079
	CRR073310	Second white 2	60.717
	CRR073311	Second white 3	35.260
	CRR073312	Silver flowering 1	26.843
	CRR073313	Silver flowering 2	6.320
	CRR073314	Silver flowering 3	19.372
	CRR073315	Gold flowering 1	520.568
	CRR073316	Gold flowering 2	449.252
	CRR073317	Gold flowering 3	101.616
	CRR073318	Tawny withering 1	75.524
	CRR073319	Tawny withering 2	103.172
	CRR073320	Tawny withering 3	74.910