Gene detail

Detail information of GWHGAAZE010106

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ADD31105.1	1.88853E-72	clp protease proteolytic subunit protein (chloroplast) [Lonicera japonica]
Swissprot	tr\|Q09FT6\|CLPP_NANDO	2E-40	ATP-dependent Clp protease proteolytic subunit {ECO:0000255\|HAMAP-Rule:MF_00444}
trEMBL	tr\|D3WBN4\|D3WBN4_LONJA	7E-73	ATP-dependent Clp protease proteolytic subunit {ECO:0000256\|RuleBase:RU003567}
TAIR10	ATCG00670.1	3E-30	plastid-encoded CLP P

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	123528244	123528651	+
GWHAAZE00000002	mRNA	123528244	123528651	+
GWHAAZE00000002	exon	123528244	123528651	+
GWHAAZE00000002	CDS	123528244	123528651	+

Transcript Sequence
>GWHTAAZE010118 AATACCCTTTCAAATTTCTGGAGACGAAGAAGCGTCTTCTTTGACGTATACAACGGACTTTATCGAAGGATTCCTTTTATAGTCCAAGAGATTGATACCGAACTCTCAAATCAAATTGTAGGTCTTATGGTATTTCTCAGTTTGGAGGGTGAGGTAAACGATCTGTATTTCTTTATATCCTCTCTCGGCGGATCCATGGTAGATGGATTCGCTATTTTTGATATGCTGGTATATTTGCCACCAACGATGCATACATTGAGTATCGGAGAATGCGCCTCAATGGCATCTTTGATCGTGGCCGGAGGAACATTTACCCAACGTATAGCATTCCCTCACAGTAGGATAATGATCCATCAACCTAATACTTTTCCTTTTGAGACACCAAGGAGGAAACTTTCCTCGAAATAA

Network for GWHGAAZE010106

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00574.24	CLP_protease	12	121	1.80E-30

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01358	clpP, CLPP	Cell cycle - Caulobacter	map04112
K01358	clpP, CLPP	Longevity regulating pathway - worm	map04212

Gene Ontology

GO term	Ontology	Name
GO:0006508	biological_process	proteolysis
GO:0004252	molecular_function	serine-type endopeptidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.286
	SRR3591706	second leaf	0.482
	SRR3591707	mature leaf	0.896
	SRR3591708	Shoot apex	0.554
	SRR3591709	Stem	0.238
	SRR3591710	White floral bud	0.509
	SRR3591711	White flower	0.328
	SRR3591712	Green floral bud	0.277
	SRR3591713	Yellow flower	0.116
SRP173429	SRR8316895	Juvenile bud stage	1.720
	SRR8316896	Juvenile bud stage	1.324
	SRR8316897	Juvenile bud stage	3.307
	SRR8316894	Third green stage	3.505
	SRR8316900	Third green stage	0.574
	SRR8316901	Third green stage	0.350
	SRR8316898	Complete white stage	0.965
	SRR8316899	Complete white stage	0.314
	SRR8316903	Complete white stage	0.626
	SRR8316902	Silver flowering stage	1.477
	SRR8316904	Silver flowering stage	1.378
	SRR8316905	Silver flowering stage	1.181
	SRR8316906	Gold flowering stage	0.143
	SRR8316907	Gold flowering stage	0.194
	SRR8316908	Gold flowering stage	0.329
SRP132670	SRR6706286	Control	0.178
	SRR6706287	Light intensity 50%	0.180
	SRR6706288	Light intensity 20%	0.260
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.619
	CNS0095593	Slightly white alabastrum(diploid) 2	1.287
	CNS0095594	Slightly white alabastrum(diploid) 3	0.757
	CNS0095595	Whole white alabastrum(diploid) 2	1.543
	CNS0095596	Whole white alabastrum(diploid) 3	0.963
	CNS0095597	Whole white alabastrum(diploid) 4	1.372
	CNS0095598	Silvery flower (diploied) 1	0.881
	CNS0095599	Silvery flower (diploied) 2	0.518
	CNS0095600	Silvery flower (diploied) 3	0.603
	CNS0095601	Golden flower (diploid) 1	0.911
	CNS0095602	Golden flower (diploid) 2	0.197
	CNS0095603	Golden flower (diploid) 3	0.552
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.646
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.122
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.330
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.560
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.125
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.667
	CNS0095610	Silvery flower (tetraploid) 1	0.688
	CNS0095611	Silvery flower (tetraploid) 2	0.095
	CNS0095612	Silvery flower (tetraploid) 3	0.363
	CNS0095613	Golden flower (tetraploid) 1	1.170
	CNS0095614	Golden flower (tetraploid) 2	0.270
	CNS0095615	Golden flower (tetraploid) 3	0.462
CRA001975	CRR073297	Stem 1	1.644
	CRR073298	Stem 2	2.877
	CRR073299	Stem 3	0.811
	CRR073300	Leaf 1	1.157
	CRR073301	Leaf 2	1.354
	CRR073302	Leaf 3	0.874
	CRR073303	Juvenile bud 1	1.939
	CRR073304	Juvenile bud 2	0.949
	CRR073305	Juvenile bud 3	2.265
	CRR073306	Third green 1	1.759
	CRR073307	Third green 2	0.483
	CRR073308	Third green 3	2.128
	CRR073309	Second white 1	2.181
	CRR073310	Second white 2	5.343
	CRR073311	Second white 3	6.771
	CRR073312	Silver flowering 1	8.324
	CRR073313	Silver flowering 2	1.228
	CRR073314	Silver flowering 3	1.945
	CRR073315	Gold flowering 1	4.278
	CRR073316	Gold flowering 2	5.240
	CRR073317	Gold flowering 3	5.238
	CRR073318	Tawny withering 1	1.202
	CRR073319	Tawny withering 2	0.971
	CRR073320	Tawny withering 3	0.740