Gene detail

Detail information of GWHGAAZE010100

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ADX99130.1	3.75338E-32	ribosomal protein S3 [Lantana camara]
Swissprot	tr\|Q68RW8\|RR3_PANGI	1E-33	30S ribosomal protein S3, chloroplastic
trEMBL	tr\|F1BDZ3\|F1BDZ3_LANCA	1E-32	30S ribosomal protein S3, chloroplastic {ECO:0000256\|RuleBase:RU003626} (Fragment)
TAIR10	ATCG00800.1	5E-27	structural constituent of ribosome

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	123402940	123404710	+
GWHAAZE00000002	mRNA	123402940	123404710	+
GWHAAZE00000002	exon	123402940	123403122	+
GWHAAZE00000002	exon	123403422	123403557	+
GWHAAZE00000002	exon	123404350	123404455	+
GWHAAZE00000002	exon	123404545	123404710	+
GWHAAZE00000002	CDS	123402940	123403122	+
GWHAAZE00000002	CDS	123403422	123403557	+
GWHAAZE00000002	CDS	123404350	123404455	+
GWHAAZE00000002	CDS	123404545	123404710	+

Transcript Sequence
>GWHTAAZE010112 ATGAAAAAGGCTATTGAATTAACTGAACAAGCAGATACAAAAGGAATTCAAGTACAAATTGCAGGGCGTATCGATGGAAAAGAAATGGCACGTGTCGAATGGATCAGAGAAGGCAGGGTTCCCCTACAAACCATTCGAGCTAAAATGGATTCTTGTTCCTATACAGTTCGAACTATCTATGGGAACGGGGAGAGGGGGAAGGGAGAAGCAGGGCTCGAAGAACGAGCCGTGCAAGGACGCGGGGATATAGCAAGTAAGCAGCAAGGTTCTCCCTTTAGGACCGACTACAACAAGCTCGCGACTCTAATAGAAACAAAGGGGCCAAATCAGCAGCAGGAGAACTGTACTAACCTGCCGCCGGTGACTTTCTCAGGGCTCCGCAGGAGAAGAAAGAAGGTCCGGGTTCAATTTATAATGAAGCGAAGTTACAGGGAGATGTTCGCCTTTGGAATGAAGATGGATGAACAGGCACTTGAGCCTGGAACTGATGAAATTCGGGGAAAACATGGAACCGGTCACTATACTGGGGGGGCGAGACATGACCGCGACTTAAGATTCAACGTTGAAAAGACTAAAGGAACGGGGGAATGA

Network for GWHGAAZE010100

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00189.21	Ribosomal_S3_C	1	61	1.20E-16

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02982	RP-S3, rpsC	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.345
	SRR3591708	Shoot apex	0.136
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.026
	SRR3591711	White flower	0.105
	SRR3591712	Green floral bud	0.178
	SRR3591713	Yellow flower	0.164
SRP173429	SRR8316895	Juvenile bud stage	0.696
	SRR8316896	Juvenile bud stage	0.516
	SRR8316897	Juvenile bud stage	1.272
	SRR8316894	Third green stage	1.745
	SRR8316900	Third green stage	0.084
	SRR8316901	Third green stage	0.338
	SRR8316898	Complete white stage	0.401
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.446
	SRR8316902	Silver flowering stage	0.698
	SRR8316904	Silver flowering stage	0.423
	SRR8316905	Silver flowering stage	0.778
	SRR8316906	Gold flowering stage	0.148
	SRR8316907	Gold flowering stage	0.162
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.098
	SRR6706287	Light intensity 50%	0.187
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.207
	CNS0095593	Slightly white alabastrum(diploid) 2	1.519
	CNS0095594	Slightly white alabastrum(diploid) 3	1.569
	CNS0095595	Whole white alabastrum(diploid) 2	0.559
	CNS0095596	Whole white alabastrum(diploid) 3	0.525
	CNS0095597	Whole white alabastrum(diploid) 4	1.642
	CNS0095598	Silvery flower (diploied) 1	0.071
	CNS0095599	Silvery flower (diploied) 2	0.246
	CNS0095600	Silvery flower (diploied) 3	0.538
	CNS0095601	Golden flower (diploid) 1	0.478
	CNS0095602	Golden flower (diploid) 2	0.078
	CNS0095603	Golden flower (diploid) 3	0.094
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.750
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.178
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.032
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.865
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.435
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.228
	CNS0095610	Silvery flower (tetraploid) 1	0.210
	CNS0095611	Silvery flower (tetraploid) 2	0.263
	CNS0095612	Silvery flower (tetraploid) 3	0.100
	CNS0095613	Golden flower (tetraploid) 1	0.127
	CNS0095614	Golden flower (tetraploid) 2	0.163
	CNS0095615	Golden flower (tetraploid) 3	0.009
CRA001975	CRR073297	Stem 1	0.535
	CRR073298	Stem 2	0.556
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.754
	CRR073301	Leaf 2	0.458
	CRR073302	Leaf 3	0.047
	CRR073303	Juvenile bud 1	1.135
	CRR073304	Juvenile bud 2	0.676
	CRR073305	Juvenile bud 3	1.276
	CRR073306	Third green 1	0.233
	CRR073307	Third green 2	0.005
	CRR073308	Third green 3	0.197
	CRR073309	Second white 1	0.326
	CRR073310	Second white 2	0.502
	CRR073311	Second white 3	0.591
	CRR073312	Silver flowering 1	1.249
	CRR073313	Silver flowering 2	0.605
	CRR073314	Silver flowering 3	0.179
	CRR073315	Gold flowering 1	0.597
	CRR073316	Gold flowering 2	0.864
	CRR073317	Gold flowering 3	0.982
	CRR073318	Tawny withering 1	0.355
	CRR073319	Tawny withering 2	0.336
	CRR073320	Tawny withering 3	0.218