Gene detail

Detail information of GWHGAAZE010098

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AEO13832.1	3.79493E-84	ribosomal protein L2 [Camellia sinensis]
Swissprot	tr\|A0A398\|RK2B_COFAR	3E-84	50S ribosomal protein L2-B, chloroplastic
trEMBL	tr\|G3EQI2\|G3EQI2_CAMSI	1E-84	Ribosomal protein L2 {ECO:0000313\|EMBL:AEO13832.1}
TAIR10	ATCG01310.1	7E-64	ribosomal protein L2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	123400137	123400538	+
GWHAAZE00000002	mRNA	123400137	123400538	+
GWHAAZE00000002	exon	123400137	123400538	+
GWHAAZE00000002	CDS	123400137	123400538	+

Transcript Sequence
>GWHTAAZE010110 ATGGCGATACATTTATACAAAACTTCTACCCCGAGCACACGCAATGGAACCGTAGACAGTCAAGTGAAATCCAATCCACGAAAAAATGGGATCTATGGACAGCATCGTTGTGGTAAAGGTCGTAATGCCAGAGGAATCATTACCGCAGGGCATAGAGGGGGAGGTCATAAGCGTCTATACCGTCAAATCGATTTTAGACGGAATGAAAAAAACATATATGGTAGAATCGTAACCATAGAATACTACCCTAATCGAAATGCATACATTTGTCTCATACACTATGGGGATGGTGAGAAGAGATATATTTTACATCCCAGAGAGGCTATAATTGGAGATACCATTGTTTCTGGTACAGAAGTTCCTATAAAAATGGGAAATGCCCCACCTTTGAGTGCGGTTTGA

Network for GWHGAAZE010098

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00181.24	Ribosomal_L2	40	116	1.80E-27

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02886	RP-L2, MRPL2, rplB	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.040
	SRR8316896	Juvenile bud stage	0.046
	SRR8316897	Juvenile bud stage	0.317
	SRR8316894	Third green stage	0.017
	SRR8316900	Third green stage	0.199
	SRR8316901	Third green stage	0.195
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.321
	SRR8316904	Silver flowering stage	0.027
	SRR8316905	Silver flowering stage	0.134
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.008
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.372
	SRR6706287	Light intensity 50%	0.022
	SRR6706288	Light intensity 20%	0.047
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.030
	CNS0095593	Slightly white alabastrum(diploid) 2	0.157
	CNS0095594	Slightly white alabastrum(diploid) 3	0.014
	CNS0095595	Whole white alabastrum(diploid) 2	0.094
	CNS0095596	Whole white alabastrum(diploid) 3	0.283
	CNS0095597	Whole white alabastrum(diploid) 4	0.305
	CNS0095598	Silvery flower (diploied) 1	0.390
	CNS0095599	Silvery flower (diploied) 2	0.305
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.170
	CNS0095603	Golden flower (diploid) 3	0.050
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.552
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.028
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.104
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.159
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.297
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.057
	CNS0095612	Silvery flower (tetraploid) 3	0.010
	CNS0095613	Golden flower (tetraploid) 1	0.204
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.400
	CRR073298	Stem 2	0.248
	CRR073299	Stem 3	0.287
	CRR073300	Leaf 1	0.751
	CRR073301	Leaf 2	0.615
	CRR073302	Leaf 3	0.305
	CRR073303	Juvenile bud 1	0.412
	CRR073304	Juvenile bud 2	0.430
	CRR073305	Juvenile bud 3	0.505
	CRR073306	Third green 1	0.349
	CRR073307	Third green 2	0.883
	CRR073308	Third green 3	0.409
	CRR073309	Second white 1	0.071
	CRR073310	Second white 2	0.333
	CRR073311	Second white 3	0.198
	CRR073312	Silver flowering 1	0.138
	CRR073313	Silver flowering 2	0.135
	CRR073314	Silver flowering 3	0.071
	CRR073315	Gold flowering 1	0.399
	CRR073316	Gold flowering 2	0.866
	CRR073317	Gold flowering 3	0.046
	CRR073318	Tawny withering 1	0.297
	CRR073319	Tawny withering 2	0.099
	CRR073320	Tawny withering 3	0.164