Gene detail

Detail information of GWHGAAZE010090

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	YP_009091736.1	2.796E-142	NADH dehydrogenase subunit 6 (mitochondrion) [Panax ginseng]
Swissprot	tr\|P60498\|NU6M_BRACM	6E-140	NADH-ubiquinone oxidoreductase chain 6
trEMBL	tr\|A0A096XF97\|A0A096XF97_PANGI	1E-142	NADH dehydrogenase subunit 6 {ECO:0000313\|EMBL:AHJ81019.1}
TAIR10	ATMG00270.1	5E-97	NADH dehydrogenase 6

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	123298733	123299350	+
GWHAAZE00000002	mRNA	123298733	123299350	+
GWHAAZE00000002	exon	123298733	123299350	+
GWHAAZE00000002	CDS	123298733	123299350	+

Transcript Sequence
>GWHTAAZE010102 ATGATACTTTCTGTTTTGTCGAGCCTTGCTTTGGTCTCTGGTTTGATGGTTGTACGTGCTAAAAATCCGGTACATTCCGTTTCGTTTCCCATCCCAGTCTTTCGCAACACTTCAGGTTTACTTCTTTTGTTAGGTCTCGACTTCTTCGCTATGATCTTCCCAGTAGTTCATATAGGAGCTATAGCCGTTTCATTCCTATTCGTTGTTATGATGTTCCATATTCAAATAGCGGAGATTCACGAAGAAGTATTGCGCTATTTACCAGTGAGTGGTATTATTGGACTGATTTTTTGGTGGGAAATGTTCTTCATTTTAGATAATGAAAGCATTCCATTACTACCAACCCAAAGAAATACGACCTCTCTGAGATATATGGTTTATGCCGGAAAGGTACGAAGTTGGACTAATTTGGAAACATTGGGCAATTTACTTTATACCTACTATTTCGTCTGGTTTTTGGTTCCTAGTCTGATTTTATTAGTAGCCATGATTGGGGCTATAGTACTGACTATGCATAGGACTACTAAGGTGAAAAGACAGGATGTATTCCGACGAAATGCTATTGATTCTAGGAGGACTATAATGAGGAGGACGACAGACCCACTCACGATCTACTAA

Network for GWHGAAZE010090

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00499.21	Oxidored_q3	14	169	3.50E-29

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03884	ND6	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Retrograde endocannabinoid signaling	map04723
		Thermogenesis	map04714

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0008137	molecular_function	NADH dehydrogenase (ubiquinone) activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.252
	SRR3591707	mature leaf	0.120
	SRR3591708	Shoot apex	0.421
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.070
	SRR3591711	White flower	0.075
	SRR3591712	Green floral bud	0.145
	SRR3591713	Yellow flower	0.150
SRP173429	SRR8316895	Juvenile bud stage	9.815
	SRR8316896	Juvenile bud stage	4.454
	SRR8316897	Juvenile bud stage	19.700
	SRR8316894	Third green stage	22.348
	SRR8316900	Third green stage	1.720
	SRR8316901	Third green stage	1.576
	SRR8316898	Complete white stage	9.119
	SRR8316899	Complete white stage	0.177
	SRR8316903	Complete white stage	10.491
	SRR8316902	Silver flowering stage	15.992
	SRR8316904	Silver flowering stage	17.058
	SRR8316905	Silver flowering stage	14.216
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.057
	SRR8316908	Gold flowering stage	0.172
SRP132670	SRR6706286	Control	0.036
	SRR6706287	Light intensity 50%	0.014
	SRR6706288	Light intensity 20%	0.035
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	5.459
	CNS0095593	Slightly white alabastrum(diploid) 2	3.674
	CNS0095594	Slightly white alabastrum(diploid) 3	6.830
	CNS0095595	Whole white alabastrum(diploid) 2	6.829
	CNS0095596	Whole white alabastrum(diploid) 3	3.206
	CNS0095597	Whole white alabastrum(diploid) 4	10.464
	CNS0095598	Silvery flower (diploied) 1	5.055
	CNS0095599	Silvery flower (diploied) 2	4.657
	CNS0095600	Silvery flower (diploied) 3	1.383
	CNS0095601	Golden flower (diploid) 1	5.810
	CNS0095602	Golden flower (diploid) 2	1.236
	CNS0095603	Golden flower (diploid) 3	1.984
	CNS0095604	Slightly white alabastrum(tetraploid) 1	5.919
	CNS0095605	Slightly white alabastrum(tetraploid) 2	5.209
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.489
	CNS0095607	Whole white alabastrum(tetraploid) 1	5.733
	CNS0095608	Whole white alabastrum(tetraploid) 2	8.294
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.584
	CNS0095610	Silvery flower (tetraploid) 1	1.274
	CNS0095611	Silvery flower (tetraploid) 2	1.184
	CNS0095612	Silvery flower (tetraploid) 3	0.788
	CNS0095613	Golden flower (tetraploid) 1	9.935
	CNS0095614	Golden flower (tetraploid) 2	4.441
	CNS0095615	Golden flower (tetraploid) 3	1.152
CRA001975	CRR073297	Stem 1	0.709
	CRR073298	Stem 2	0.652
	CRR073299	Stem 3	0.125
	CRR073300	Leaf 1	0.194
	CRR073301	Leaf 2	0.327
	CRR073302	Leaf 3	0.074
	CRR073303	Juvenile bud 1	0.507
	CRR073304	Juvenile bud 2	0.096
	CRR073305	Juvenile bud 3	1.381
	CRR073306	Third green 1	0.423
	CRR073307	Third green 2	0.126
	CRR073308	Third green 3	0.356
	CRR073309	Second white 1	0.861
	CRR073310	Second white 2	1.579
	CRR073311	Second white 3	4.602
	CRR073312	Silver flowering 1	3.553
	CRR073313	Silver flowering 2	1.063
	CRR073314	Silver flowering 3	3.008
	CRR073315	Gold flowering 1	0.107
	CRR073316	Gold flowering 2	1.232
	CRR073317	Gold flowering 3	1.534
	CRR073318	Tawny withering 1	1.067
	CRR073319	Tawny withering 2	1.050
	CRR073320	Tawny withering 3	0.301