Gene detail

Detail information of GWHGAAZE010044

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ADD31166.1	3.2666E-162	RNA polymerase beta' subunit protein (chloroplast) [Lonicera japonica]
Swissprot	tr\|Q68S15\|RPOC1_PANGI	2E-148	DNA-directed RNA polymerase subunit beta' {ECO:0000255\|HAMAP-Rule:MF_01323}
trEMBL	tr\|D3WBT6\|D3WBT6_LONJA	1E-162	DNA-directed RNA polymerase {ECO:0000256\|RuleBase:RU004279}
TAIR10	ATCG00180.1	2E-110	DNA-directed RNA polymerase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	122469196	122469897	-
GWHAAZE00000002	mRNA	122469196	122469897	-
GWHAAZE00000002	exon	122469196	122469897	-
GWHAAZE00000002	CDS	122469196	122469897	-

Transcript Sequence
>GWHTAAZE010056 ATGGAATTAGCTAAGCATTTTATTCGAACAAATATAGAACCAGAATGGATGGTTTTGTGTCTATTACCAGTTCTTCCTCCTGAGTTGAGACCGCTTTTTCGGACAGATAGTAGTAGGCTAGTGAGGTCGGATATTAATGAACTCTATAGACGAGTTATCTATCGGAACAATACTCTTACTGATCTATTAACAACAAGTCGATTTGCGCCGGGAGAATTAGTAATGTGTCAGGAGAAATTGGTACAAGAAGCCGTGGATTCACTTCTTGATAATGGAATAGGCGGGCAACCAACGAAGGACGGTTCTAATCAAGTTTACAAGTCGTTTTCAGATAGAATTGCAGGTAAAGAGGGAAGATTTCGTGAGACTCTGCTTGGCAAACGAGTCGATTATTCAGGGCGTTCCGTTATTGTCGTGGGCCCTTCACTTTCATTACATCGATGTGGATTGCCTCGCGAAATAGCAATAGAACTTTTCCAGACATTTGTAATTCGTGGTCTAATTAGACAGCATCTTGCTTCGAACATACGAGTTGCCAAGAGTCAAATTCGGGAAAAAGAACCGATTGTATGGGAAATACTTCAGGAAGTTATGCAGGGGCATCCGGTATTGCTGAATAGAGCGCCCACTCTGCATAGATTAGGCATACAGGCATTTCAGCCCGTTTTAGTGGAAGGGCGTGCTATTTGTTTACATCCGTGA

Network for GWHGAAZE010044

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04997.13	RNA_pol_Rpb1_1	7	124	6.60E-30
PF00623.21	RNA_pol_Rpb1_2	126	177	1.60E-08
PF00623.21	RNA_pol_Rpb1_2	176	232	1.60E-08

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03046	rpoC	RNA polymerase	map03020

Gene Ontology

GO term	Ontology	Name
GO:0006351	biological_process	transcription, DNA-templated
GO:0003677	molecular_function	DNA binding
GO:0003899	molecular_function	DNA-directed 5'-3' RNA polymerase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.031
	SRR3591706	second leaf	0.039
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.289
	SRR3591709	Stem	0.040
	SRR3591710	White floral bud	0.038
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.122
	SRR3591713	Yellow flower	0.094
SRP173429	SRR8316895	Juvenile bud stage	0.963
	SRR8316896	Juvenile bud stage	0.515
	SRR8316897	Juvenile bud stage	1.630
	SRR8316894	Third green stage	1.557
	SRR8316900	Third green stage	0.392
	SRR8316901	Third green stage	0.219
	SRR8316898	Complete white stage	0.449
	SRR8316899	Complete white stage	0.118
	SRR8316903	Complete white stage	0.358
	SRR8316902	Silver flowering stage	1.156
	SRR8316904	Silver flowering stage	0.821
	SRR8316905	Silver flowering stage	0.799
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.040
	SRR8316908	Gold flowering stage	0.027
SRP132670	SRR6706286	Control	0.029
	SRR6706287	Light intensity 50%	0.083
	SRR6706288	Light intensity 20%	0.060
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.680
	CNS0095593	Slightly white alabastrum(diploid) 2	0.343
	CNS0095594	Slightly white alabastrum(diploid) 3	0.760
	CNS0095595	Whole white alabastrum(diploid) 2	1.033
	CNS0095596	Whole white alabastrum(diploid) 3	1.436
	CNS0095597	Whole white alabastrum(diploid) 4	0.956
	CNS0095598	Silvery flower (diploied) 1	0.425
	CNS0095599	Silvery flower (diploied) 2	0.879
	CNS0095600	Silvery flower (diploied) 3	0.422
	CNS0095601	Golden flower (diploid) 1	0.759
	CNS0095602	Golden flower (diploid) 2	0.245
	CNS0095603	Golden flower (diploid) 3	0.206
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.455
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.398
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.358
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.336
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.362
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.470
	CNS0095610	Silvery flower (tetraploid) 1	0.179
	CNS0095611	Silvery flower (tetraploid) 2	0.379
	CNS0095612	Silvery flower (tetraploid) 3	0.233
	CNS0095613	Golden flower (tetraploid) 1	0.399
	CNS0095614	Golden flower (tetraploid) 2	0.306
	CNS0095615	Golden flower (tetraploid) 3	0.077
CRA001975	CRR073297	Stem 1	0.827
	CRR073298	Stem 2	0.529
	CRR073299	Stem 3	0.313
	CRR073300	Leaf 1	0.345
	CRR073301	Leaf 2	0.310
	CRR073302	Leaf 3	0.944
	CRR073303	Juvenile bud 1	1.970
	CRR073304	Juvenile bud 2	0.612
	CRR073305	Juvenile bud 3	0.900
	CRR073306	Third green 1	0.647
	CRR073307	Third green 2	0.140
	CRR073308	Third green 3	0.903
	CRR073309	Second white 1	0.382
	CRR073310	Second white 2	1.120
	CRR073311	Second white 3	2.224
	CRR073312	Silver flowering 1	1.825
	CRR073313	Silver flowering 2	0.388
	CRR073314	Silver flowering 3	0.811
	CRR073315	Gold flowering 1	1.208
	CRR073316	Gold flowering 2	0.977
	CRR073317	Gold flowering 3	0.493
	CRR073318	Tawny withering 1	0.377
	CRR073319	Tawny withering 2	0.135
	CRR073320	Tawny withering 3	0.215