Gene detail

Detail information of GWHGAAZE010043

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ADO13883.1	3.58192E-63	RNA polymerase beta subunit, partial (chloroplast) [Weigela hortensis]
Swissprot	tr\|A7Y3B4\|RPOC2_IPOPU	5E-64	DNA-directed RNA polymerase subunit beta'' {ECO:0000255\|HAMAP-Rule:MF_01324}
trEMBL	tr\|E2DGU0\|E2DGU0_WEIHO	1E-63	DNA-directed RNA polymerase {ECO:0000256\|RuleBase:RU004279} (Fragment)
TAIR10	ATCG00170.1	5E-42	DNA-directed RNA polymerase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	122467229	122467630	-
GWHAAZE00000002	mRNA	122467229	122467630	-
GWHAAZE00000002	exon	122467229	122467630	-
GWHAAZE00000002	CDS	122467229	122467630	-

Transcript Sequence
>GWHTAAZE010055 ATGGGTCCACGATGCATTGCCGCCAGAAAGAAAGATATTGGGATTGGACTTGTCAACCGATTCATAACCTTTCGAGCACAACCAATATCTATCCGAACTCCCTTTACTTGTAGGAGTACATCTTGGATCTGTCGATTATGTTATGGCCGGAGTCCTACTCATGGTGACCTGGTCGAGTTGGGAGAAGCTGTAGGTATTATTGCAGGTCAATCTATTGGAGAACCGGGTACTCAATTAACATTAAGAACTTTTCATACCGGCGGAGTATTCACGGGAGGTACTGCAGAACATGTACGAGCCCCCTTTTCCTTACCAGAAATAGGAAGTTTAGTCCGTTTCAAGAGAAGAGAGCTTTTCCCTCTGTTTCTTAACGAGCAGTTGATGAGCCGGTCTTCGAACTAG

Network for GWHGAAZE010043

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04998.18	RNA_pol_Rpb1_5	16	94	1.90E-18

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03046	rpoC	RNA polymerase	map03020

Gene Ontology

GO term	Ontology	Name
GO:0006351	biological_process	transcription, DNA-templated
GO:0003677	molecular_function	DNA binding
GO:0003899	molecular_function	DNA-directed 5'-3' RNA polymerase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.132
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.021
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.002
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.123
	SRR8316898	Complete white stage	0.068
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.233
	SRR8316904	Silver flowering stage	0.070
	SRR8316905	Silver flowering stage	0.342
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.841
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.106
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.285
	CNS0095595	Whole white alabastrum(diploid) 2	0.209
	CNS0095596	Whole white alabastrum(diploid) 3	0.467
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.141
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.102
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.014
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.189
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.227
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.175
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.069
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.227
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.068
	CRR073303	Juvenile bud 1	0.006
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.071
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.912
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.237
	CRR073312	Silver flowering 1	0.096
	CRR073313	Silver flowering 2	0.029
	CRR073314	Silver flowering 3	0.708
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000