Gene detail

Detail information of GWHGAAZE010023

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	YP_007905721.1	2.15964E-63	ribosomal protein S14 (mitochondrion) [Liriodendron tulipifera]
Swissprot	tr\|P05716\|RT14_VICFA	7E-63	Ribosomal protein S14, mitochondrial
trEMBL	tr\|M9W8U4\|M9W8U4_LIRTU	8E-64	Ribosomal protein S14 {ECO:0000313\|EMBL:AGJ90418.1}
TAIR10	AT2G34520.1	2E-43	mitochondrial ribosomal protein S14

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	122144445	122144747	+
GWHAAZE00000002	mRNA	122144445	122144747	+
GWHAAZE00000002	exon	122144445	122144747	+
GWHAAZE00000002	CDS	122144445	122144747	+

Transcript Sequence
>GWHTAAZE010035 ATGTCGGAGAAGCGAAATATACGGGATCACAAACGTAGATTGCTCGCGGCTAAATATGAATTGAGACGAAAGCTTTATAAAGCCTTTTGTAAAGATCCCAATCTTCCTAGTGAGATGCGGGACAAACATCGTTATAAGTTGTCCAAGTTGCCAAGAAATAGTTCCTTTGCACGAGTAAGAAACCGATGTATTTCCACGGGTCGCCCTCGTTCCGTATATGAGTTATTTCGAATTTCTCGTATCGTTTTTCGTGGATTAGCATCTCGAGGTCCTTTGATGGGCATAAAGAAATCGTCTTGGTAG

Network for GWHGAAZE010023

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00253.22	Ribosomal_S14	46	99	3.40E-21

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02954	RP-S14, MRPS14, rpsN	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.346
	SRR3591708	Shoot apex	0.727
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.176
	SRR3591711	White flower	0.176
	SRR3591712	Green floral bud	0.571
	SRR3591713	Yellow flower	0.700
SRP173429	SRR8316895	Juvenile bud stage	9.392
	SRR8316896	Juvenile bud stage	6.828
	SRR8316897	Juvenile bud stage	14.424
	SRR8316894	Third green stage	21.385
	SRR8316900	Third green stage	1.707
	SRR8316901	Third green stage	1.253
	SRR8316898	Complete white stage	6.681
	SRR8316899	Complete white stage	0.337
	SRR8316903	Complete white stage	7.682
	SRR8316902	Silver flowering stage	8.764
	SRR8316904	Silver flowering stage	11.266
	SRR8316905	Silver flowering stage	8.026
	SRR8316906	Gold flowering stage	0.496
	SRR8316907	Gold flowering stage	0.464
	SRR8316908	Gold flowering stage	0.113
SRP132670	SRR6706286	Control	0.464
	SRR6706287	Light intensity 50%	0.706
	SRR6706288	Light intensity 20%	0.659
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	5.984
	CNS0095593	Slightly white alabastrum(diploid) 2	2.587
	CNS0095594	Slightly white alabastrum(diploid) 3	6.567
	CNS0095595	Whole white alabastrum(diploid) 2	6.652
	CNS0095596	Whole white alabastrum(diploid) 3	8.132
	CNS0095597	Whole white alabastrum(diploid) 4	11.648
	CNS0095598	Silvery flower (diploied) 1	7.819
	CNS0095599	Silvery flower (diploied) 2	6.053
	CNS0095600	Silvery flower (diploied) 3	2.363
	CNS0095601	Golden flower (diploid) 1	5.816
	CNS0095602	Golden flower (diploid) 2	0.908
	CNS0095603	Golden flower (diploid) 3	2.354
	CNS0095604	Slightly white alabastrum(tetraploid) 1	6.119
	CNS0095605	Slightly white alabastrum(tetraploid) 2	4.127
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.104
	CNS0095607	Whole white alabastrum(tetraploid) 1	8.809
	CNS0095608	Whole white alabastrum(tetraploid) 2	11.197
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.054
	CNS0095610	Silvery flower (tetraploid) 1	2.160
	CNS0095611	Silvery flower (tetraploid) 2	2.152
	CNS0095612	Silvery flower (tetraploid) 3	1.835
	CNS0095613	Golden flower (tetraploid) 1	6.725
	CNS0095614	Golden flower (tetraploid) 2	2.711
	CNS0095615	Golden flower (tetraploid) 3	0.753
CRA001975	CRR073297	Stem 1	3.769
	CRR073298	Stem 2	3.020
	CRR073299	Stem 3	1.239
	CRR073300	Leaf 1	2.598
	CRR073301	Leaf 2	2.050
	CRR073302	Leaf 3	0.561
	CRR073303	Juvenile bud 1	2.711
	CRR073304	Juvenile bud 2	2.051
	CRR073305	Juvenile bud 3	7.936
	CRR073306	Third green 1	3.367
	CRR073307	Third green 2	1.227
	CRR073308	Third green 3	3.313
	CRR073309	Second white 1	3.893
	CRR073310	Second white 2	9.430
	CRR073311	Second white 3	20.793
	CRR073312	Silver flowering 1	11.581
	CRR073313	Silver flowering 2	5.336
	CRR073314	Silver flowering 3	7.949
	CRR073315	Gold flowering 1	1.631
	CRR073316	Gold flowering 2	3.312
	CRR073317	Gold flowering 3	3.112
	CRR073318	Tawny withering 1	2.580
	CRR073319	Tawny withering 2	3.798
	CRR073320	Tawny withering 3	2.098