Gene detail

Detail information of GWHGAAZE009909

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010326573.1	2.09266E-19	PREDICTED: U1 small nuclear ribonucleoprotein A isoform X1 [Solanum lycopersicum]
Swissprot	tr\|Q0DKM4\|RU1A_ORYSJ	9E-17	U1 small nuclear ribonucleoprotein A
trEMBL	tr\|M1D4N7\|M1D4N7_SOLTU	2E-20	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400081385}
TAIR10	AT2G30260.1	3E-13	U2 small nuclear ribonucleoprotein B

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	119655849	119656135	-
GWHAAZE00000002	mRNA	119655849	119656135	-
GWHAAZE00000002	exon	119655849	119656019	-
GWHAAZE00000002	exon	119656115	119656135	-
GWHAAZE00000002	CDS	119656115	119656135	-
GWHAAZE00000002	CDS	119655849	119656019	-

Transcript Sequence
>GWHTAAZE009921 ATGGCTGGTGCTAAATCTACGTTCTGCCAATATCCGGGCTTTAAGGAAGTTAATAATGGTGATGATGCTAAACCAAGAATCACCTTTGTAGAGTATGGGGATGAGATGCAATCTACCATTGCAATGCAGGGACTTCAAAGTTTCAAGATTACTGCTGACCATCCAATGGTGATCAACAATGCGAAGAAGTAA

Network for GWHGAAZE009909

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K11091	SNRPA	Spliceosome	map03040

Gene Ontology

GO term	Ontology	Name
GO:0003676	molecular_function	nucleic acid binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	4.653
	SRR3591706	second leaf	1.869
	SRR3591707	mature leaf	0.806
	SRR3591708	Shoot apex	6.724
	SRR3591709	Stem	2.119
	SRR3591710	White floral bud	0.745
	SRR3591711	White flower	1.198
	SRR3591712	Green floral bud	2.803
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	2.675
	SRR8316896	Juvenile bud stage	2.885
	SRR8316897	Juvenile bud stage	2.082
	SRR8316894	Third green stage	0.724
	SRR8316900	Third green stage	0.925
	SRR8316901	Third green stage	2.373
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.150
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	2.093
	SRR6706287	Light intensity 50%	2.472
	SRR6706288	Light intensity 20%	2.189
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.333
	CNS0095593	Slightly white alabastrum(diploid) 2	2.574
	CNS0095594	Slightly white alabastrum(diploid) 3	3.500
	CNS0095595	Whole white alabastrum(diploid) 2	4.114
	CNS0095596	Whole white alabastrum(diploid) 3	2.462
	CNS0095597	Whole white alabastrum(diploid) 4	4.639
	CNS0095598	Silvery flower (diploied) 1	0.367
	CNS0095599	Silvery flower (diploied) 2	0.451
	CNS0095600	Silvery flower (diploied) 3	0.137
	CNS0095601	Golden flower (diploid) 1	0.615
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.148
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.614
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.611
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.038
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.152
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.627
	CNS0095609	Whole white alabastrum(tetraploid) 3	3.294
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.138
	CNS0095612	Silvery flower (tetraploid) 3	0.184
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.939
	CRR073298	Stem 2	1.408
	CRR073299	Stem 3	0.343
	CRR073300	Leaf 1	0.709
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.171
	CRR073303	Juvenile bud 1	0.208
	CRR073304	Juvenile bud 2	0.374
	CRR073305	Juvenile bud 3	0.178
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.016
	CRR073315	Gold flowering 1	0.420
	CRR073316	Gold flowering 2	1.669
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.368
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.083