Gene detail

Detail information of GWHGAAZE009770

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP14938.1	4.3281E-104	unnamed protein product [Coffea canephora]
Swissprot	tr\|A6MW12\|RK24_RHDSA	2E-14	50S ribosomal protein L24, chloroplastic
trEMBL	tr\|A0A068V4X6\|A0A068V4X6_COFCA	2E-104	Coffea canephora DH200=94 genomic scaffold, scaffold_93 {ECO:0000313\|EMBL:CDP14938.1}
TAIR10	AT5G23535.1	5E-77	KOW domain-containing protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	116817853	116820587	-
GWHAAZE00000002	mRNA	116817853	116820587	-
GWHAAZE00000002	exon	116817853	116817935	-
GWHAAZE00000002	exon	116818654	116818790	-
GWHAAZE00000002	exon	116818883	116818986	-
GWHAAZE00000002	exon	116820308	116820403	-
GWHAAZE00000002	exon	116820528	116820587	-
GWHAAZE00000002	CDS	116820528	116820587	-
GWHAAZE00000002	CDS	116820308	116820403	-
GWHAAZE00000002	CDS	116818883	116818986	-
GWHAAZE00000002	CDS	116818654	116818790	-
GWHAAZE00000002	CDS	116817853	116817935	-

Transcript Sequence
>GWHTAAZE009782 ATGGGTTGGAAGGCAGCTCAAAAACTCATACATCACTGGAAGATTCTAAGAGGCGATAATGTAATGATAATTAGGGGCAAAGATAAAGGTGAGACTGGCATGATTAAGCGTGTGATCCGCTCTCAAAATCGTGTTATTGTGGAGGGAAAAAATTTGGTAAAGAAACATATTAAACAGGGGCAAGGCCATGAAGGAGGGATTTTTACTGTTGAAGCCCCACTTCATGTTTCAAATGTTCAAGTTGTAGACCCAGTGACAGGGAAGCCTTGTAAGGTTGGAATAAGGTATCTTGAAGATGGTACCAAAGTAAGAGTTTCTAGAGGTATAGGTGCATCAGGGTCGATAATACCTCGTCCTGAGATCTTAAAGATAAGGACTACACCAAGACCAACAGTTGCTGGCCCAAAGGACACTCCTATGGATCTGGTTCTGGAGAAGACATACGATGCTAAAACTGGAAAAGGAATGCCTCATCTTTAA

Network for GWHGAAZE009770

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00467.30	KOW	17	48	3.40E-10
PF17136.5	ribosomal_L24	51	108	4.30E-22

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02895	RP-L24, MRPL24, rplX	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	10.626
	SRR3591706	second leaf	6.503
	SRR3591707	mature leaf	6.855
	SRR3591708	Shoot apex	10.994
	SRR3591709	Stem	12.927
	SRR3591710	White floral bud	5.075
	SRR3591711	White flower	2.805
	SRR3591712	Green floral bud	4.764
	SRR3591713	Yellow flower	2.315
SRP173429	SRR8316895	Juvenile bud stage	18.419
	SRR8316896	Juvenile bud stage	21.483
	SRR8316897	Juvenile bud stage	11.223
	SRR8316894	Third green stage	7.494
	SRR8316900	Third green stage	25.858
	SRR8316901	Third green stage	21.173
	SRR8316898	Complete white stage	4.236
	SRR8316899	Complete white stage	24.394
	SRR8316903	Complete white stage	6.923
	SRR8316902	Silver flowering stage	4.587
	SRR8316904	Silver flowering stage	5.080
	SRR8316905	Silver flowering stage	2.329
	SRR8316906	Gold flowering stage	9.857
	SRR8316907	Gold flowering stage	7.752
	SRR8316908	Gold flowering stage	8.442
SRP132670	SRR6706286	Control	5.829
	SRR6706287	Light intensity 50%	5.450
	SRR6706288	Light intensity 20%	5.706
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	26.796
	CNS0095593	Slightly white alabastrum(diploid) 2	25.180
	CNS0095594	Slightly white alabastrum(diploid) 3	28.089
	CNS0095595	Whole white alabastrum(diploid) 2	22.811
	CNS0095596	Whole white alabastrum(diploid) 3	21.135
	CNS0095597	Whole white alabastrum(diploid) 4	18.906
	CNS0095598	Silvery flower (diploied) 1	13.307
	CNS0095599	Silvery flower (diploied) 2	20.400
	CNS0095600	Silvery flower (diploied) 3	12.243
	CNS0095601	Golden flower (diploid) 1	18.840
	CNS0095602	Golden flower (diploid) 2	13.764
	CNS0095603	Golden flower (diploid) 3	14.428
	CNS0095604	Slightly white alabastrum(tetraploid) 1	27.740
	CNS0095605	Slightly white alabastrum(tetraploid) 2	32.777
	CNS0095606	Slightly white alabastrum(tetraploid) 3	31.660
	CNS0095607	Whole white alabastrum(tetraploid) 1	19.731
	CNS0095608	Whole white alabastrum(tetraploid) 2	20.123
	CNS0095609	Whole white alabastrum(tetraploid) 3	28.976
	CNS0095610	Silvery flower (tetraploid) 1	18.371
	CNS0095611	Silvery flower (tetraploid) 2	14.166
	CNS0095612	Silvery flower (tetraploid) 3	14.525
	CNS0095613	Golden flower (tetraploid) 1	12.943
	CNS0095614	Golden flower (tetraploid) 2	18.631
	CNS0095615	Golden flower (tetraploid) 3	6.233
CRA001975	CRR073297	Stem 1	6.739
	CRR073298	Stem 2	7.405
	CRR073299	Stem 3	5.672
	CRR073300	Leaf 1	9.424
	CRR073301	Leaf 2	6.066
	CRR073302	Leaf 3	6.848
	CRR073303	Juvenile bud 1	6.547
	CRR073304	Juvenile bud 2	6.264
	CRR073305	Juvenile bud 3	5.872
	CRR073306	Third green 1	0.779
	CRR073307	Third green 2	0.362
	CRR073308	Third green 3	1.018
	CRR073309	Second white 1	2.684
	CRR073310	Second white 2	1.515
	CRR073311	Second white 3	1.009
	CRR073312	Silver flowering 1	1.043
	CRR073313	Silver flowering 2	1.979
	CRR073314	Silver flowering 3	0.534
	CRR073315	Gold flowering 1	3.551
	CRR073316	Gold flowering 2	4.432
	CRR073317	Gold flowering 3	1.608
	CRR073318	Tawny withering 1	5.762
	CRR073319	Tawny withering 2	3.964
	CRR073320	Tawny withering 3	6.137