Gene detail

Detail information of GWHGAAZE009325

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011082379.1	2.2852E-147	PREDICTED: cytochrome P450 86A1 [Sesamum indicum]
Swissprot	tr\|P48422\|C86A1_ARATH	1E-137	Cytochrome P450 86A1
trEMBL	tr\|D7SK14\|D7SK14_VITVI	3E-147	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI15990.3}
TAIR10	AT5G58860.1	3E-112	cytochrome P450, family 86, subfamily A, polypeptide 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	107878200	107878988	+
GWHAAZE00000002	mRNA	107878200	107878988	+
GWHAAZE00000002	exon	107878200	107878452	+
GWHAAZE00000002	exon	107878495	107878988	+
GWHAAZE00000002	CDS	107878200	107878452	+
GWHAAZE00000002	CDS	107878495	107878988	+

Transcript Sequence
>GWHTAAZE009335 ATGACGGAGGCATTAACCGCGAGGAAGTTAACTCCGTCAGACGATCTCCTATCCCGCTTTATGAAAAAACGAGATGTTGACGGCAACCTCTTCCCTAGCCACGTCCTTAAGCGCATCGCCCTCAATTTCGTCCTAGCTGGACGTGATACGTCATCAGTCGCGCTGAGCTGGTTCTTTTGGCTAGTGATGAACAACCCTAATGTGGAAAATAAGATCGTTAACGAGATCGCAACGGTGTTAAGAGAGACACGCGACGAAGCAGATAAGTTGGTTTATCTAAAAGCAGCATTGGCTGAGACGCTCCGACTATACCCCTCAGTCCCCGAGGATTTCAAGTACGTTATTAACGACGATGTTTTACCGGACGGGACCAAAGTGCCGGCCGGTTCTACGGTGACGTACTCAATTTATTCGGTGGGGAGGATGAAGAGTGTGTGGGGTGAGGATTGTATGGAATTTAAACCGGAGAGGTGGCTTTCGGCCGGTCTGGACCGGTTCGAACCGCCAAAAGATGGGTATAAATTTGTGGCGTTTAACGGTGGACCGAGAACTTGTTTGGGAAAGGACTTGGCCTATTTACAAATGAAGTCTGTTGTGTCTGCGGTTCTACTTCGTTACCGGCTATCACTGGTTCCCGGTCACCGGGTCGAACAGAAAATGTCACTCACTCTATTTATGAAGAATGGGTTGAAAGTTTATTTGAAGCCACGTGGGCTGGCAGTTTATGGGGCTGCCGCGTGTGCGTGA

Network for GWHGAAZE009325

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00067.23	p450	14	232	2.70E-49

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K15401	CYP86A1	Fatty acid degradation	map00071
K15401	CYP86A1	Cutin, suberine and wax biosynthesis	map00073

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0005506	molecular_function	iron ion binding
GO:0016705	molecular_function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen
GO:0020037	molecular_function	heme binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.540
	SRR3591708	Shoot apex	0.096
	SRR3591709	Stem	0.039
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.127
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.115
	SRR8316896	Juvenile bud stage	2.046
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.072
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.155
	SRR8316898	Complete white stage	0.209
	SRR8316899	Complete white stage	0.375
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.521
SRP132670	SRR6706286	Control	0.128
	SRR6706287	Light intensity 50%	0.084
	SRR6706288	Light intensity 20%	0.151
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.677
	CNS0095593	Slightly white alabastrum(diploid) 2	0.080
	CNS0095594	Slightly white alabastrum(diploid) 3	0.994
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.056
	CNS0095597	Whole white alabastrum(diploid) 4	0.218
	CNS0095598	Silvery flower (diploied) 1	0.302
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.091
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.062
	CNS0095603	Golden flower (diploid) 3	0.116
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.065
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.189
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.159
	CNS0095612	Silvery flower (tetraploid) 3	0.354
	CNS0095613	Golden flower (tetraploid) 1	0.143
	CNS0095614	Golden flower (tetraploid) 2	0.121
	CNS0095615	Golden flower (tetraploid) 3	0.093
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.131
	CRR073299	Stem 3	0.146
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.080
	CRR073302	Leaf 3	0.158
	CRR073303	Juvenile bud 1	0.355
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.049
	CRR073306	Third green 1	0.353
	CRR073307	Third green 2	0.054
	CRR073308	Third green 3	0.100
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.945
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.138
	CRR073315	Gold flowering 1	1.036
	CRR073316	Gold flowering 2	1.197
	CRR073317	Gold flowering 3	2.640
	CRR073318	Tawny withering 1	217.100
	CRR073319	Tawny withering 2	44.305
	CRR073320	Tawny withering 3	279.777