Gene detail

Detail information of GWHGAAZE009296

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AFK41064.1	8.42394E-90	unknown [Medicago truncatula]
Swissprot	tr\|P27880\|HSP12_MEDSA	1E-86	18.2 kDa class I heat shock protein
trEMBL	tr\|I3SLC2\|I3SLC2_MEDTR	3E-90	Uncharacterized protein {ECO:0000313\|EMBL:AFK41064.1}
TAIR10	AT2G29500.1	5E-56	HSP20-like chaperones superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	107251294	107251767	+
GWHAAZE00000002	mRNA	107251294	107251767	+
GWHAAZE00000002	exon	107251294	107251767	+
GWHAAZE00000002	CDS	107251294	107251767	+

Transcript Sequence
>GWHTAAZE009306 ATGTCGTTGATTCCAAGTTTCTTTAATGGCAATGGTCGAAGGAGCAACATATTCGATCCCTTCTCTCTGGATGTTTGGGACCCGTTTAAGGATTTCCCATTCTCCTCTTCCTCAGAAGCTTCGAGAGAAACTTCTGCTCTGGTCAACACTCGAATCGATTGGAAGGAAACGCCGCAAGCTCATGTGTTTAAGGCCGATCTTCCGGGGATTAAGAAGGAAGAAGTGAAAGTAGAGGTTGAAGACGACAGAGTTTTGCAGATTAGAGGAGAGAGAAACAGGGAGGTGGAAGAGAAAAACGATACCTGGCATAGGGTTGAACGGAGCTCAGGGCAGTTTATGAGGAGGTTTAGGTTGCCGGAGAATGCAAAGATGGATCAGATAAAGGCTTCAATGGAGAATGGAGTGCTCACTGTTACCATTCCGAAAGAGGAAGAGAAGAAGGCTGATGTTAAATCTATTGAGATTTCTGGTTAA

Network for GWHGAAZE009296

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00011.22	HSP20	53	156	4.20E-32

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13993	HSP20	Protein processing in endoplasmic reticulum	map04141

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	52.598
	SRR3591706	second leaf	12.658
	SRR3591707	mature leaf	34.592
	SRR3591708	Shoot apex	27.802
	SRR3591709	Stem	46.637
	SRR3591710	White floral bud	14.960
	SRR3591711	White flower	23.016
	SRR3591712	Green floral bud	24.287
	SRR3591713	Yellow flower	3.264
SRP173429	SRR8316895	Juvenile bud stage	247.218
	SRR8316896	Juvenile bud stage	870.854
	SRR8316897	Juvenile bud stage	408.697
	SRR8316894	Third green stage	3.625
	SRR8316900	Third green stage	15.518
	SRR8316901	Third green stage	68.545
	SRR8316898	Complete white stage	0.759
	SRR8316899	Complete white stage	3.788
	SRR8316903	Complete white stage	0.936
	SRR8316902	Silver flowering stage	3.501
	SRR8316904	Silver flowering stage	2.388
	SRR8316905	Silver flowering stage	1.543
	SRR8316906	Gold flowering stage	23.231
	SRR8316907	Gold flowering stage	23.109
	SRR8316908	Gold flowering stage	19.136
SRP132670	SRR6706286	Control	14.631
	SRR6706287	Light intensity 50%	11.053
	SRR6706288	Light intensity 20%	11.129
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	8.749
	CNS0095593	Slightly white alabastrum(diploid) 2	10.172
	CNS0095594	Slightly white alabastrum(diploid) 3	11.737
	CNS0095595	Whole white alabastrum(diploid) 2	6.841
	CNS0095596	Whole white alabastrum(diploid) 3	5.183
	CNS0095597	Whole white alabastrum(diploid) 4	7.102
	CNS0095598	Silvery flower (diploied) 1	8.756
	CNS0095599	Silvery flower (diploied) 2	478.090
	CNS0095600	Silvery flower (diploied) 3	192.914
	CNS0095601	Golden flower (diploid) 1	980.761
	CNS0095602	Golden flower (diploid) 2	221.172
	CNS0095603	Golden flower (diploid) 3	224.352
	CNS0095604	Slightly white alabastrum(tetraploid) 1	76.158
	CNS0095605	Slightly white alabastrum(tetraploid) 2	81.339
	CNS0095606	Slightly white alabastrum(tetraploid) 3	128.529
	CNS0095607	Whole white alabastrum(tetraploid) 1	50.113
	CNS0095608	Whole white alabastrum(tetraploid) 2	34.495
	CNS0095609	Whole white alabastrum(tetraploid) 3	83.017
	CNS0095610	Silvery flower (tetraploid) 1	21.588
	CNS0095611	Silvery flower (tetraploid) 2	45.051
	CNS0095612	Silvery flower (tetraploid) 3	69.159
	CNS0095613	Golden flower (tetraploid) 1	31.888
	CNS0095614	Golden flower (tetraploid) 2	21.062
	CNS0095615	Golden flower (tetraploid) 3	1.607
CRA001975	CRR073297	Stem 1	1.496
	CRR073298	Stem 2	1.728
	CRR073299	Stem 3	2.930
	CRR073300	Leaf 1	2.625
	CRR073301	Leaf 2	1.271
	CRR073302	Leaf 3	3.892
	CRR073303	Juvenile bud 1	1.789
	CRR073304	Juvenile bud 2	1.778
	CRR073305	Juvenile bud 3	2.168
	CRR073306	Third green 1	2.036
	CRR073307	Third green 2	2.136
	CRR073308	Third green 3	1.276
	CRR073309	Second white 1	1.019
	CRR073310	Second white 2	1.529
	CRR073311	Second white 3	0.699
	CRR073312	Silver flowering 1	1.195
	CRR073313	Silver flowering 2	0.406
	CRR073314	Silver flowering 3	0.418
	CRR073315	Gold flowering 1	4.933
	CRR073316	Gold flowering 2	3.317
	CRR073317	Gold flowering 3	4.239
	CRR073318	Tawny withering 1	2.447
	CRR073319	Tawny withering 2	2.141
	CRR073320	Tawny withering 3	2.119