Gene detail

Detail information of GWHGAAZE008900

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006362889.1	1.78778E-43	PREDICTED: DNA polymerase epsilon subunit 3-like [Solanum tuberosum]
Swissprot	tr\|Q9FGJ3\|NFYB2_ARATH	3E-10	Nuclear transcription factor Y subunit B-2
trEMBL	tr\|M1CHV0\|M1CHV0_SOLTU	7E-44	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400067767}
TAIR10	AT2G27470.1	2E-26	nuclear factor Y, subunit B11

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	96480666	96481923	+
GWHAAZE00000002	mRNA	96480666	96481923	+
GWHAAZE00000002	exon	96480666	96480868	+
GWHAAZE00000002	exon	96481770	96481923	+
GWHAAZE00000002	CDS	96480666	96480868	+
GWHAAZE00000002	CDS	96481770	96481923	+

Transcript Sequence
>GWHTAAZE008910 TTAGGTATAGCGAGAGAGATGGCGGAGAAAGTGGTGGTGGAGGCGGAAGAATTGCCGAAGACAATCGTAAGGAGGATAGTGAAGGATAAACTCTCTCAGATGTCGTCGGCTTCAAAGGAAGGCACCGATATTTCAGTTCTCCGTGAGGCTCTTCAGGGTTTCTCCGAGAGCTCTCGAATCTTCATTCACTATCTCTCCGCTACTGCAAATGACGTATGCAAGGAGAACAAGAGGCAAACAATCAACGCTGAAGATGTTTTTAAAGCACTTGAAGAAATCGAGTTTCCTGAGTTTGTTGAACCTCTTAGAGCTTATCTTGAAGGTAGGTGGATATCTAAAATCCCTTTATGTAGATAA

Network for GWHGAAZE008900

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00808.24	CBFD_NFYB_HMF	17	90	4.10E-08

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	NF-YB

KEGG pathway

KO	Enzyme	pathway	mapID
K02326	POLE3	DNA replication	map03030
		Base excision repair	map03410
		Nucleotide excision repair	map03420

Gene Ontology

GO term	Ontology	Name
GO:0046982	molecular_function	protein heterodimerization activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	20.268
	SRR3591706	second leaf	4.689
	SRR3591707	mature leaf	7.917
	SRR3591708	Shoot apex	37.090
	SRR3591709	Stem	9.712
	SRR3591710	White floral bud	11.685
	SRR3591711	White flower	20.185
	SRR3591712	Green floral bud	20.276
	SRR3591713	Yellow flower	20.305
SRP173429	SRR8316895	Juvenile bud stage	10.729
	SRR8316896	Juvenile bud stage	12.677
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	5.780
	SRR8316900	Third green stage	16.185
	SRR8316901	Third green stage	15.447
	SRR8316898	Complete white stage	6.449
	SRR8316899	Complete white stage	15.090
	SRR8316903	Complete white stage	6.594
	SRR8316902	Silver flowering stage	5.662
	SRR8316904	Silver flowering stage	4.257
	SRR8316905	Silver flowering stage	2.325
	SRR8316906	Gold flowering stage	13.400
	SRR8316907	Gold flowering stage	22.240
	SRR8316908	Gold flowering stage	5.229
SRP132670	SRR6706286	Control	16.668
	SRR6706287	Light intensity 50%	16.150
	SRR6706288	Light intensity 20%	19.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	12.909
	CNS0095593	Slightly white alabastrum(diploid) 2	8.993
	CNS0095594	Slightly white alabastrum(diploid) 3	8.283
	CNS0095595	Whole white alabastrum(diploid) 2	11.244
	CNS0095596	Whole white alabastrum(diploid) 3	8.569
	CNS0095597	Whole white alabastrum(diploid) 4	6.883
	CNS0095598	Silvery flower (diploied) 1	13.530
	CNS0095599	Silvery flower (diploied) 2	12.228
	CNS0095600	Silvery flower (diploied) 3	8.705
	CNS0095601	Golden flower (diploid) 1	5.876
	CNS0095602	Golden flower (diploid) 2	7.743
	CNS0095603	Golden flower (diploid) 3	9.638
	CNS0095604	Slightly white alabastrum(tetraploid) 1	7.293
	CNS0095605	Slightly white alabastrum(tetraploid) 2	11.101
	CNS0095606	Slightly white alabastrum(tetraploid) 3	11.777
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.022
	CNS0095608	Whole white alabastrum(tetraploid) 2	4.396
	CNS0095609	Whole white alabastrum(tetraploid) 3	10.679
	CNS0095610	Silvery flower (tetraploid) 1	9.777
	CNS0095611	Silvery flower (tetraploid) 2	10.445
	CNS0095612	Silvery flower (tetraploid) 3	9.875
	CNS0095613	Golden flower (tetraploid) 1	9.021
	CNS0095614	Golden flower (tetraploid) 2	9.105
	CNS0095615	Golden flower (tetraploid) 3	3.838
CRA001975	CRR073297	Stem 1	9.938
	CRR073298	Stem 2	8.962
	CRR073299	Stem 3	10.806
	CRR073300	Leaf 1	10.372
	CRR073301	Leaf 2	8.760
	CRR073302	Leaf 3	7.530
	CRR073303	Juvenile bud 1	10.919
	CRR073304	Juvenile bud 2	8.238
	CRR073305	Juvenile bud 3	4.977
	CRR073306	Third green 1	3.822
	CRR073307	Third green 2	3.230
	CRR073308	Third green 3	4.812
	CRR073309	Second white 1	3.600
	CRR073310	Second white 2	5.226
	CRR073311	Second white 3	5.915
	CRR073312	Silver flowering 1	3.208
	CRR073313	Silver flowering 2	0.969
	CRR073314	Silver flowering 3	1.976
	CRR073315	Gold flowering 1	6.617
	CRR073316	Gold flowering 2	7.675
	CRR073317	Gold flowering 3	7.559
	CRR073318	Tawny withering 1	7.560
	CRR073319	Tawny withering 2	10.849
	CRR073320	Tawny withering 3	7.965