Gene detail

Detail information of GWHGAAZE008798

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	EYU40170.1	3.42643E-28	hypothetical protein MIMGU_mgv1a021549mg [Erythranthe guttata]
trEMBL	tr\|A0A022RMG9\|A0A022RMG9_ERYGU	1E-28	Uncharacterized protein {ECO:0000313\|EMBL:EYU40170.1}
TAIR10	AT1G75230.2	1E-20	DNA glycosylase superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	92493254	92493418	+
GWHAAZE00000002	mRNA	92493254	92493418	+
GWHAAZE00000002	exon	92493254	92493418	+
GWHAAZE00000002	CDS	92493254	92493418	+

Transcript Sequence
>GWHTAAZE008808 ATGGATGATAGGTCTCTTTTTACTATGCTATCAATGATGAAGGGAATTGGGTCTTGGTCAATTCACATGTTTATGATCTTTTCTCTTCACAGACCGGATGTTTTGCCGGTGAGTGATTTAAGGGTTAAAAAAGGGGTGCAGATTCTTAATGGGCTTGAAGAGTTG

Network for GWHGAAZE008798

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01247	alkA	Base excision repair	map03410

Gene Ontology

GO term	Ontology	Name
GO:0006281	biological_process	DNA repair
GO:0003824	molecular_function	catalytic activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.119
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.018
	SRR3591710	White floral bud	0.022
	SRR3591711	White flower	0.415
	SRR3591712	Green floral bud	0.011
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.124
	SRR8316896	Juvenile bud stage	0.040
	SRR8316897	Juvenile bud stage	0.026
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.061
	SRR8316901	Third green stage	0.055
	SRR8316898	Complete white stage	0.063
	SRR8316899	Complete white stage	0.233
	SRR8316903	Complete white stage	0.012
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.007
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.277
	SRR8316907	Gold flowering stage	0.133
	SRR8316908	Gold flowering stage	0.130
SRP132670	SRR6706286	Control	0.113
	SRR6706287	Light intensity 50%	0.104
	SRR6706288	Light intensity 20%	0.168
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.146
	CNS0095593	Slightly white alabastrum(diploid) 2	0.161
	CNS0095594	Slightly white alabastrum(diploid) 3	0.129
	CNS0095595	Whole white alabastrum(diploid) 2	0.116
	CNS0095596	Whole white alabastrum(diploid) 3	0.014
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.316
	CNS0095599	Silvery flower (diploied) 2	0.031
	CNS0095600	Silvery flower (diploied) 3	0.243
	CNS0095601	Golden flower (diploid) 1	0.053
	CNS0095602	Golden flower (diploid) 2	0.156
	CNS0095603	Golden flower (diploid) 3	0.288
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.282
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.100
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.320
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.085
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.132
	CNS0095610	Silvery flower (tetraploid) 1	0.186
	CNS0095611	Silvery flower (tetraploid) 2	0.147
	CNS0095612	Silvery flower (tetraploid) 3	0.304
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.261
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.182
	CRR073298	Stem 2	0.402
	CRR073299	Stem 3	0.379
	CRR073300	Leaf 1	0.181
	CRR073301	Leaf 2	0.296
	CRR073302	Leaf 3	0.088
	CRR073303	Juvenile bud 1	0.312
	CRR073304	Juvenile bud 2	0.123
	CRR073305	Juvenile bud 3	0.709
	CRR073306	Third green 1	0.109
	CRR073307	Third green 2	0.073
	CRR073308	Third green 3	0.016
	CRR073309	Second white 1	0.353
	CRR073310	Second white 2	0.203
	CRR073311	Second white 3	0.136
	CRR073312	Silver flowering 1	0.115
	CRR073313	Silver flowering 2	0.373
	CRR073314	Silver flowering 3	0.114
	CRR073315	Gold flowering 1	0.657
	CRR073316	Gold flowering 2	0.371
	CRR073317	Gold flowering 3	0.568
	CRR073318	Tawny withering 1	0.874
	CRR073319	Tawny withering 2	0.457
	CRR073320	Tawny withering 3	0.798