Gene detail

Detail information of GWHGAAZE008781

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010097632.1	8.1494E-112	Ornithine carbamoyltransferase [Morus notabilis]
Swissprot	tr\|O50039\|OTC_ARATH	6E-105	Ornithine carbamoyltransferase, chloroplastic (Precursor)
trEMBL	tr\|W9RD90\|W9RD90_9ROSA	3E-112	Ornithine carbamoyltransferase {ECO:0000313\|EMBL:EXB70258.1}
TAIR10	AT1G75330.1	3E-85	ornithine carbamoyltransferase

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	91575002	91582909	+
GWHAAZE00000002	mRNA	91575002	91582909	+
GWHAAZE00000002	exon	91575002	91575196	+
GWHAAZE00000002	exon	91576479	91576535	+
GWHAAZE00000002	exon	91576737	91576898	+
GWHAAZE00000002	exon	91582727	91582909	+
GWHAAZE00000002	CDS	91575002	91575196	+
GWHAAZE00000002	CDS	91576479	91576535	+
GWHAAZE00000002	CDS	91576737	91576898	+
GWHAAZE00000002	CDS	91582727	91582909	+

Transcript Sequence
>GWHTAAZE008791 ATGGCAATGATATTCGCAAAGCCATCAATGGGGACACGGGTTTCATTTGAGACTGGATTTTTCTTGCTCGGTGGCCACGCACTATATTTGAGACCAGATGATATCCAAATGGGGAAGTGTGAAGAAACCCGTGATGTGGCTCACGTTCTTTGTCGCTATAATGATGTCATTATGGCTCGTCTTTTTGCTCATCAGATCATGGCAGATGCACTGACAATAATTGAGCACATTGGTCAATCGGAAGGAACCAAGACAGTTAAAAAGGCACAACAAGCTGGAGTCGGCAAAATTGAGATAACTAATGATCCGAAGGAAGCTGTTAAAGGAGCCAATGTAGTGTATTCGGATGTGTGGGCCAGCATGGATCAGAAGGAAGAAGCTGCATATCGCCGCCAAGTGTTTCGTGGATTCCAGGTGGATGAAAAACTTATGAAGATAGCAGGACCAAACGCGTATTTTATGCATTGCTTACCGGCAGAAAGAGGGGTGGAGGTTATGGATGGTGTTATCGAAGCTCCGTACTCTATTGTCTTCCCTCAAGCTGAGAACCGAATGCACGCTCAGAATGCAATAATGCTTCATTCGCTTGGTTTGTGA

Network for GWHGAAZE008781

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02729.22	OTCace_N	1	66	2.60E-17
PF00185.25	OTCace	84	193	3.50E-40

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00611	OTC, argF, argI	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Biosynthesis of amino acids	map01230
		Arginine biosynthesis	map00220

Gene Ontology

GO term	Ontology	Name
GO:0006520	biological_process	cellular amino acid metabolic process
GO:0016597	molecular_function	amino acid binding
GO:0016743	molecular_function	carboxyl- or carbamoyltransferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.399
	SRR3591706	second leaf	2.149
	SRR3591707	mature leaf	1.418
	SRR3591708	Shoot apex	2.846
	SRR3591709	Stem	2.980
	SRR3591710	White floral bud	3.259
	SRR3591711	White flower	1.478
	SRR3591712	Green floral bud	2.727
	SRR3591713	Yellow flower	2.548
SRP173429	SRR8316895	Juvenile bud stage	1.065
	SRR8316896	Juvenile bud stage	1.005
	SRR8316897	Juvenile bud stage	0.046
	SRR8316894	Third green stage	0.738
	SRR8316900	Third green stage	1.932
	SRR8316901	Third green stage	0.944
	SRR8316898	Complete white stage	0.072
	SRR8316899	Complete white stage	0.413
	SRR8316903	Complete white stage	0.207
	SRR8316902	Silver flowering stage	0.061
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.613
	SRR6706287	Light intensity 50%	0.744
	SRR6706288	Light intensity 20%	0.870
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.636
	CNS0095593	Slightly white alabastrum(diploid) 2	1.246
	CNS0095594	Slightly white alabastrum(diploid) 3	0.265
	CNS0095595	Whole white alabastrum(diploid) 2	0.737
	CNS0095596	Whole white alabastrum(diploid) 3	0.494
	CNS0095597	Whole white alabastrum(diploid) 4	1.592
	CNS0095598	Silvery flower (diploied) 1	0.952
	CNS0095599	Silvery flower (diploied) 2	1.850
	CNS0095600	Silvery flower (diploied) 3	0.142
	CNS0095601	Golden flower (diploid) 1	2.049
	CNS0095602	Golden flower (diploid) 2	0.199
	CNS0095603	Golden flower (diploid) 3	0.541
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.437
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.762
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.772
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.369
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.189
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.006
	CNS0095610	Silvery flower (tetraploid) 1	1.234
	CNS0095611	Silvery flower (tetraploid) 2	1.317
	CNS0095612	Silvery flower (tetraploid) 3	0.529
	CNS0095613	Golden flower (tetraploid) 1	0.562
	CNS0095614	Golden flower (tetraploid) 2	1.289
	CNS0095615	Golden flower (tetraploid) 3	0.420
CRA001975	CRR073297	Stem 1	1.283
	CRR073298	Stem 2	0.879
	CRR073299	Stem 3	0.079
	CRR073300	Leaf 1	1.492
	CRR073301	Leaf 2	0.670
	CRR073302	Leaf 3	0.609
	CRR073303	Juvenile bud 1	0.380
	CRR073304	Juvenile bud 2	0.163
	CRR073305	Juvenile bud 3	0.329
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.011
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.119
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.175
	CRR073316	Gold flowering 2	0.395
	CRR073317	Gold flowering 3	0.944
	CRR073318	Tawny withering 1	0.354
	CRR073319	Tawny withering 2	0.135
	CRR073320	Tawny withering 3	0.060