Gene detail

Detail information of GWHGAAZE008656

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007208731.1	6.75637E-48	hypothetical protein PRUPE_ppa000389m2g, partial [Prunus persica]
Swissprot	tr\|Q56YN8\|SMC3_ARATH	3E-45	Structural maintenance of chromosomes protein 3
trEMBL	tr\|M5WT05\|M5WT05_PRUPE	3E-48	Uncharacterized protein {ECO:0000313\|EMBL:EMJ09930.1} (Fragment)
TAIR10	AT2G27170.2	8E-40	Structural maintenance of chromosomes (SMC) family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	86821403	86824473	+
GWHAAZE00000002	mRNA	86821403	86824473	+
GWHAAZE00000002	exon	86821403	86821417	+
GWHAAZE00000002	exon	86821513	86821588	+
GWHAAZE00000002	exon	86824018	86824056	+
GWHAAZE00000002	exon	86824178	86824245	+
GWHAAZE00000002	exon	86824354	86824473	+
GWHAAZE00000002	CDS	86821403	86821417	+
GWHAAZE00000002	CDS	86821513	86821588	+
GWHAAZE00000002	CDS	86824018	86824056	+
GWHAAZE00000002	CDS	86824178	86824245	+
GWHAAZE00000002	CDS	86824354	86824473	+

Transcript Sequence
>GWHTAAZE008666 ATGTATATAAAACAGGTTATTATTGAGGGGTTTAAGAGCTACAAAGAACAAGTTGCTACCGAGCCTTTCAGTCCAAAAGTAATTTGCGTTGTTGGTGCTAATGGATCTGGCAAATCGAACTTTTTCCAAGCTATCCGTTTTGTGATAAGTGACCTCTTCCAACAACTGCGCACTGAAGACAGGCATAAACTCCTACATGAAGGTGCAGGACGCCAATTGCTAACTGCTTTTGTGGAGATTGTGTTTGACAACTCTGAACAACGCATCCCTGTAATATTTAGTAACCAGCTTACTCGTCTTTGCAGATATTTATTTTAA

Network for GWHGAAZE008656

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02463.20	SMC_N	2	90	2.60E-25

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K06669	SMC3, CSPG6	Cell cycle	map04110
		Cell cycle - yeast	map04111
		Meiosis - yeast	map04113
		Oocyte meiosis	map04114

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.104
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.360
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.353
	SRR8316896	Juvenile bud stage	0.082
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.095
	SRR8316900	Third green stage	0.108
	SRR8316901	Third green stage	0.056
	SRR8316898	Complete white stage	0.028
	SRR8316899	Complete white stage	0.492
	SRR8316903	Complete white stage	0.531
	SRR8316902	Silver flowering stage	0.074
	SRR8316904	Silver flowering stage	0.181
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.301
	SRR8316907	Gold flowering stage	0.155
	SRR8316908	Gold flowering stage	0.317
SRP132670	SRR6706286	Control	0.443
	SRR6706287	Light intensity 50%	0.591
	SRR6706288	Light intensity 20%	1.131
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.459
	CNS0095593	Slightly white alabastrum(diploid) 2	0.241
	CNS0095594	Slightly white alabastrum(diploid) 3	0.182
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.023
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.055
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.172
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.505
	CRR073298	Stem 2	0.942
	CRR073299	Stem 3	0.216
	CRR073300	Leaf 1	0.287
	CRR073301	Leaf 2	0.081
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.095
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.077
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000