Gene detail

Detail information of GWHGAAZE008579

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004300967.1	2.2312E-117	PREDICTED: probable receptor-like protein kinase At5g39020-like [Fragaria vesca subsp. vesca]
Swissprot	tr\|D7SFH9\|GPDL2_ARATH	5E-84	Glycerophosphodiester phosphodiesterase protein kinase domain-containing GDPDL2 {ECO:0000305} (Precursor)
trEMBL	tr\|M1D0D7\|M1D0D7_SOLTU	5E-119	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400078564}
TAIR10	AT1G66980.1	7E-69	suppressor of npr1-1 constitutive 4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	83472821	83473513	-
GWHAAZE00000002	mRNA	83472821	83473513	-
GWHAAZE00000002	exon	83472821	83473513	-
GWHAAZE00000002	CDS	83472821	83473513	-

Transcript Sequence
>GWHTAAZE008589 ATGCCCAACGGATCCCTTGAGAAATTCGTATACGATGGAATTTCCTCAACGAATCGCCAACTGGGCTGGGATAAATCTTACCGTATTGCAATAGGCATTGCTCGAGGATTAGAGTACTTACACCGGGGCTGCAACACGCGTATTCTGCATTTCGATATAAAGCCTCAAAACATTCTTCTAGACCAAGACTTTATTCCAAAGATCTCTGACTTTGGGCTTGCTAAATTATGTCCTGGTAAAGAGAGCGCTGTATCAATGTTGAACGCTAGGGGGACTATCGGTTACATTGCTCCCGAAGTATTTTGCAGAAACTTCGGACAGGTCTCTCACAAGTCAGATGTGTATAGTTACGGAATGATGGTACTAGAAATTGTTGGAGGGAGAAAGAATATCGAGGTTGAAGTTGGTCATACTAGCGAAATTTACTTTCCTGACTGGATATATAGAAAACTCGAATCGGATAAAGAACTTGGAATGCACGGGATTATGAACGAAGATGAAAATGTGTACGCAAGAAAGATGATAATAGTGAGCTTGTGGTGCATACAAAGCGATCCGTCAAAAAGGCCATCGATGAGTAGAGTGGTGGAGATGCTAGAAGGGAGTTTGGAGTCTCTGGAAATCCCTCCAAAACCTGTTCTGTCTTCTCCCACACTGTCACCACCACATTCTTCAACCACAGAAACAAGCTAA

Network for GWHGAAZE008579

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00069.26	Pkinase	5	197	5.20E-28

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_LRK10L-2

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	8.594
	SRR3591706	second leaf	7.031
	SRR3591707	mature leaf	20.484
	SRR3591708	Shoot apex	9.625
	SRR3591709	Stem	6.020
	SRR3591710	White floral bud	3.646
	SRR3591711	White flower	4.641
	SRR3591712	Green floral bud	6.858
	SRR3591713	Yellow flower	4.813
SRP173429	SRR8316895	Juvenile bud stage	6.266
	SRR8316896	Juvenile bud stage	11.579
	SRR8316897	Juvenile bud stage	7.719
	SRR8316894	Third green stage	5.080
	SRR8316900	Third green stage	9.937
	SRR8316901	Third green stage	9.147
	SRR8316898	Complete white stage	0.398
	SRR8316899	Complete white stage	7.909
	SRR8316903	Complete white stage	2.834
	SRR8316902	Silver flowering stage	0.679
	SRR8316904	Silver flowering stage	1.020
	SRR8316905	Silver flowering stage	0.276
	SRR8316906	Gold flowering stage	1.814
	SRR8316907	Gold flowering stage	1.820
	SRR8316908	Gold flowering stage	1.340
SRP132670	SRR6706286	Control	4.850
	SRR6706287	Light intensity 50%	5.348
	SRR6706288	Light intensity 20%	5.999
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	7.186
	CNS0095593	Slightly white alabastrum(diploid) 2	7.954
	CNS0095594	Slightly white alabastrum(diploid) 3	4.936
	CNS0095595	Whole white alabastrum(diploid) 2	6.083
	CNS0095596	Whole white alabastrum(diploid) 3	3.471
	CNS0095597	Whole white alabastrum(diploid) 4	5.843
	CNS0095598	Silvery flower (diploied) 1	6.020
	CNS0095599	Silvery flower (diploied) 2	8.798
	CNS0095600	Silvery flower (diploied) 3	1.847
	CNS0095601	Golden flower (diploid) 1	5.571
	CNS0095602	Golden flower (diploid) 2	3.155
	CNS0095603	Golden flower (diploid) 3	3.217
	CNS0095604	Slightly white alabastrum(tetraploid) 1	9.255
	CNS0095605	Slightly white alabastrum(tetraploid) 2	7.719
	CNS0095606	Slightly white alabastrum(tetraploid) 3	14.634
	CNS0095607	Whole white alabastrum(tetraploid) 1	5.819
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.813
	CNS0095609	Whole white alabastrum(tetraploid) 3	6.591
	CNS0095610	Silvery flower (tetraploid) 1	3.949
	CNS0095611	Silvery flower (tetraploid) 2	5.148
	CNS0095612	Silvery flower (tetraploid) 3	1.841
	CNS0095613	Golden flower (tetraploid) 1	2.939
	CNS0095614	Golden flower (tetraploid) 2	2.248
	CNS0095615	Golden flower (tetraploid) 3	1.090
CRA001975	CRR073297	Stem 1	5.882
	CRR073298	Stem 2	6.054
	CRR073299	Stem 3	3.096
	CRR073300	Leaf 1	4.804
	CRR073301	Leaf 2	5.092
	CRR073302	Leaf 3	4.942
	CRR073303	Juvenile bud 1	2.048
	CRR073304	Juvenile bud 2	1.451
	CRR073305	Juvenile bud 3	2.075
	CRR073306	Third green 1	0.554
	CRR073307	Third green 2	0.707
	CRR073308	Third green 3	1.071
	CRR073309	Second white 1	0.578
	CRR073310	Second white 2	0.274
	CRR073311	Second white 3	0.130
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.820
	CRR073314	Silver flowering 3	0.141
	CRR073315	Gold flowering 1	5.548
	CRR073316	Gold flowering 2	7.267
	CRR073317	Gold flowering 3	4.976
	CRR073318	Tawny withering 1	2.322
	CRR073319	Tawny withering 2	3.320
	CRR073320	Tawny withering 3	1.766