Gene detail

Detail information of GWHGAAZE008136

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010269705.1	2.14551E-64	PREDICTED: RNA-binding protein 8A-B [Nelumbo nucifera]
Swissprot	tr\|Q9FMG4\|SC35_ARATH	0.00000003	Serine/arginine-rich splicing factor SC35
trEMBL	tr\|A0A068UL83\|A0A068UL83_COFCA	2E-58	Coffea canephora DH200=94 genomic scaffold, scaffold_37 {ECO:0000313\|EMBL:CDP09290.1}
TAIR10	AT1G51510.1	5E-36	RNA-binding (RRM/RBD/RNP motifs) family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	62388941	62393060	+
GWHAAZE00000002	mRNA	62388941	62393060	+
GWHAAZE00000002	exon	62388941	62389010	+
GWHAAZE00000002	exon	62389304	62389440	+
GWHAAZE00000002	exon	62392393	62392538	+
GWHAAZE00000002	exon	62393015	62393060	+
GWHAAZE00000002	CDS	62388941	62389010	+
GWHAAZE00000002	CDS	62389304	62389440	+
GWHAAZE00000002	CDS	62392393	62392538	+
GWHAAZE00000002	CDS	62393015	62393060	+

Transcript Sequence
>GWHTAAZE008144 ATGTTTGGTAGTACTGGGTCTTGGCCCCTTTTTGCCTTACGTGGTGCATTTGGAGTGAGCCAAATAAGAGCCATTGAAGGATGGATTATTCTCGTGACTGGAATTCATGAAGAAGCACAAGAGGATGACATTCAGAATGCATTTGGTGATTTTGGGGAGATGAAGAATCTGCACCTGAATCTTGATCGTAGAACTGGATTTGTTAAGGGGTATGCACTGATTGAATATGAGCACTTTGAGGAAGCAGAGAAAGCTATATCTGTAATGGATGGTGCTGAACTGCTCACACAAATTATCAGTGTTGATTGGGCATTCAGCAAAGGTCCCTTCAGAAGGAGGAATACCAGGAGGAGATCGCCACGTGGGCATCGTTCACGGAGTCCCAGGAGAAGGTTTTGA

Network for GWHGAAZE008136

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00076.23	RRM_1	30	95	1.40E-13

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K12876	RBM8A, Y14	Spliceosome	map03040
		RNA transport	map03013
		mRNA surveillance pathway	map03015

Gene Ontology

GO term	Ontology	Name
GO:0006396	biological_process	RNA processing
GO:0005634	cellular_component	nucleus
GO:0005737	cellular_component	cytoplasm
GO:0003676	molecular_function	nucleic acid binding
GO:0003729	molecular_function	mRNA binding
GO:0003723	molecular_function	RNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	14.897
	SRR3591706	second leaf	14.984
	SRR3591707	mature leaf	9.425
	SRR3591708	Shoot apex	31.156
	SRR3591709	Stem	14.721
	SRR3591710	White floral bud	22.794
	SRR3591711	White flower	15.889
	SRR3591712	Green floral bud	22.499
	SRR3591713	Yellow flower	13.210
SRP173429	SRR8316895	Juvenile bud stage	15.335
	SRR8316896	Juvenile bud stage	26.124
	SRR8316897	Juvenile bud stage	13.304
	SRR8316894	Third green stage	10.785
	SRR8316900	Third green stage	33.307
	SRR8316901	Third green stage	31.019
	SRR8316898	Complete white stage	12.730
	SRR8316899	Complete white stage	34.768
	SRR8316903	Complete white stage	18.989
	SRR8316902	Silver flowering stage	14.569
	SRR8316904	Silver flowering stage	16.379
	SRR8316905	Silver flowering stage	7.900
	SRR8316906	Gold flowering stage	27.260
	SRR8316907	Gold flowering stage	26.733
	SRR8316908	Gold flowering stage	32.423
SRP132670	SRR6706286	Control	20.809
	SRR6706287	Light intensity 50%	21.031
	SRR6706288	Light intensity 20%	23.823
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	28.239
	CNS0095593	Slightly white alabastrum(diploid) 2	27.453
	CNS0095594	Slightly white alabastrum(diploid) 3	24.591
	CNS0095595	Whole white alabastrum(diploid) 2	31.875
	CNS0095596	Whole white alabastrum(diploid) 3	35.418
	CNS0095597	Whole white alabastrum(diploid) 4	36.620
	CNS0095598	Silvery flower (diploied) 1	21.361
	CNS0095599	Silvery flower (diploied) 2	17.609
	CNS0095600	Silvery flower (diploied) 3	18.303
	CNS0095601	Golden flower (diploid) 1	23.052
	CNS0095602	Golden flower (diploid) 2	21.435
	CNS0095603	Golden flower (diploid) 3	20.141
	CNS0095604	Slightly white alabastrum(tetraploid) 1	41.884
	CNS0095605	Slightly white alabastrum(tetraploid) 2	52.463
	CNS0095606	Slightly white alabastrum(tetraploid) 3	20.390
	CNS0095607	Whole white alabastrum(tetraploid) 1	58.032
	CNS0095608	Whole white alabastrum(tetraploid) 2	60.141
	CNS0095609	Whole white alabastrum(tetraploid) 3	32.697
	CNS0095610	Silvery flower (tetraploid) 1	21.947
	CNS0095611	Silvery flower (tetraploid) 2	24.337
	CNS0095612	Silvery flower (tetraploid) 3	21.215
	CNS0095613	Golden flower (tetraploid) 1	15.719
	CNS0095614	Golden flower (tetraploid) 2	21.468
	CNS0095615	Golden flower (tetraploid) 3	19.229
CRA001975	CRR073297	Stem 1	25.250
	CRR073298	Stem 2	20.251
	CRR073299	Stem 3	30.160
	CRR073300	Leaf 1	21.999
	CRR073301	Leaf 2	25.045
	CRR073302	Leaf 3	29.511
	CRR073303	Juvenile bud 1	25.721
	CRR073304	Juvenile bud 2	25.949
	CRR073305	Juvenile bud 3	16.045
	CRR073306	Third green 1	11.060
	CRR073307	Third green 2	16.277
	CRR073308	Third green 3	13.222
	CRR073309	Second white 1	15.429
	CRR073310	Second white 2	10.293
	CRR073311	Second white 3	10.353
	CRR073312	Silver flowering 1	8.515
	CRR073313	Silver flowering 2	14.725
	CRR073314	Silver flowering 3	13.505
	CRR073315	Gold flowering 1	28.451
	CRR073316	Gold flowering 2	33.421
	CRR073317	Gold flowering 3	33.616
	CRR073318	Tawny withering 1	31.494
	CRR073319	Tawny withering 2	24.607
	CRR073320	Tawny withering 3	37.855