Gene detail

Detail information of GWHGAAZE008090

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP04654.1	9.6989E-76	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q9SIT9\|NFYB7_ARATH	2E-57	Nuclear transcription factor Y subunit B-7
trEMBL	tr\|A0A068U8Y9\|A0A068U8Y9_COFCA	4E-76	Coffea canephora DH200=94 genomic scaffold, scaffold_13 {ECO:0000313\|EMBL:CDP04654.1}
TAIR10	AT2G13570.1	4E-46	nuclear factor Y, subunit B7

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	61087024	61087584	-
GWHAAZE00000002	mRNA	61087024	61087584	-
GWHAAZE00000002	exon	61087024	61087584	-
GWHAAZE00000002	CDS	61087024	61087584	-

Transcript Sequence
>GWHTAAZE008098 AACAATAACAATAACAATAACAGTAGCAATAACAATAAAGAGCAAGATCGATTCCTTCCCATAGCCAATGTTGGCCGGATAATGAAAAAGGTGATTCCCGGGAATGGGAAAATCTCAAAGGACGCTAAAGAGACTGTCCAAGAATGCGTGTCGGAGTTCATTAGCTTTGTGACTGGAGAAGCGTCCGATAAATGCCAGCGCGAGAAGAGAAAGACGATCAATGGCGAAGATATTCTTTACGCTATCACAATACTTGGGTTTGAGGATTACGTAAATCCACTCAAACACTATCTCAACAAGTACAGAGTTTTGGAAGGTGACAAGCTTAACAACAATGTTCCTAATAAGCAACAAAGATTGTTGGAGCAAAATCAAGTACAAGGTGGTTTACCTTCTCCTCATACAAACATTGTATATTCTTCTACAAATCTCATCTCTCCGCCATCTTTTGTGTCATCGGCCGATCAATCGTTTTCTTCATCCCTACCTTTTCCGCAAAATTCGATTCAAACGCAATTGCATCATCAACAAGAACAAATTGATTCAATGGGGCATTGGTGA

Network for GWHGAAZE008090

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00808.24	CBFD_NFYB_HMF	18	82	2.90E-27

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	NF-YB

KEGG pathway

KO	Enzyme	pathway	mapID
K08065	NFYB, HAP3	Antigen processing and presentation	map04612

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0005634	cellular_component	nucleus
GO:0043565	molecular_function	sequence-specific DNA binding
GO:0046982	molecular_function	protein heterodimerization activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.259
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.355
	SRR3591710	White floral bud	18.575
	SRR3591711	White flower	0.923
	SRR3591712	Green floral bud	59.059
	SRR3591713	Yellow flower	0.284
SRP173429	SRR8316895	Juvenile bud stage	9.235
	SRR8316896	Juvenile bud stage	26.386
	SRR8316897	Juvenile bud stage	10.554
	SRR8316894	Third green stage	6.244
	SRR8316900	Third green stage	44.944
	SRR8316901	Third green stage	45.940
	SRR8316898	Complete white stage	0.077
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.122
	SRR8316905	Silver flowering stage	0.383
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	14.754
	SRR6706287	Light intensity 50%	15.982
	SRR6706288	Light intensity 20%	13.499
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	40.282
	CNS0095593	Slightly white alabastrum(diploid) 2	25.222
	CNS0095594	Slightly white alabastrum(diploid) 3	51.360
	CNS0095595	Whole white alabastrum(diploid) 2	75.143
	CNS0095596	Whole white alabastrum(diploid) 3	95.312
	CNS0095597	Whole white alabastrum(diploid) 4	88.264
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	1.741
	CNS0095600	Silvery flower (diploied) 3	0.545
	CNS0095601	Golden flower (diploid) 1	0.307
	CNS0095602	Golden flower (diploid) 2	0.102
	CNS0095603	Golden flower (diploid) 3	0.658
	CNS0095604	Slightly white alabastrum(tetraploid) 1	65.307
	CNS0095605	Slightly white alabastrum(tetraploid) 2	62.748
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.154
	CNS0095607	Whole white alabastrum(tetraploid) 1	117.724
	CNS0095608	Whole white alabastrum(tetraploid) 2	134.674
	CNS0095609	Whole white alabastrum(tetraploid) 3	61.349
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	1.118
	CNS0095612	Silvery flower (tetraploid) 3	1.503
	CNS0095613	Golden flower (tetraploid) 1	0.532
	CNS0095614	Golden flower (tetraploid) 2	0.057
	CNS0095615	Golden flower (tetraploid) 3	0.991
CRA001975	CRR073297	Stem 1	11.714
	CRR073298	Stem 2	8.707
	CRR073299	Stem 3	4.978
	CRR073300	Leaf 1	25.598
	CRR073301	Leaf 2	23.207
	CRR073302	Leaf 3	13.182
	CRR073303	Juvenile bud 1	25.933
	CRR073304	Juvenile bud 2	22.473
	CRR073305	Juvenile bud 3	0.204
	CRR073306	Third green 1	2.386
	CRR073307	Third green 2	1.763
	CRR073308	Third green 3	1.936
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.589
	CRR073311	Second white 3	0.572
	CRR073312	Silver flowering 1	0.516
	CRR073313	Silver flowering 2	0.439
	CRR073314	Silver flowering 3	0.449
	CRR073315	Gold flowering 1	1.726
	CRR073316	Gold flowering 2	0.093
	CRR073317	Gold flowering 3	0.700
	CRR073318	Tawny withering 1	1.796
	CRR073319	Tawny withering 2	1.286
	CRR073320	Tawny withering 3	0.768