Gene detail

Detail information of GWHGAAZE008054

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	EYU23795.1	7.85727E-67	hypothetical protein MIMGU_mgv1a015337mg [Erythranthe guttata]
Swissprot	tr\|O80363\|RK17_TOBAC	3E-13	50S ribosomal protein L17, chloroplastic (Precursor)
trEMBL	tr\|A0A022QB96\|A0A022QB96_ERYGU	3E-67	Uncharacterized protein {ECO:0000313\|EMBL:EYU23795.1}
TAIR10	AT5G64650.1	2E-42	Ribosomal protein L17 family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	60339541	60341181	+
GWHAAZE00000002	mRNA	60339541	60341181	+
GWHAAZE00000002	exon	60339541	60339632	+
GWHAAZE00000002	exon	60339717	60339794	+
GWHAAZE00000002	exon	60341031	60341181	+
GWHAAZE00000002	CDS	60339541	60339632	+
GWHAAZE00000002	CDS	60339717	60339794	+
GWHAAZE00000002	CDS	60341031	60341181	+

Transcript Sequence
>GWHTAAZE008062 GGTAGTCTTTGTGCTGCTCGGCGTGCCGCTGCCTTTGTGCGAGGGGATGATGTCATTCACAAGCTATTTACAGAACTGGCTTATCGATACAAAGATAGAGCAGGTGGATACACAAGACTCCTCCGAACTCGAATAAGAGTTGGTGATGCGGCACCAATGGCCTATATCGAGTTTATAGATAGAGAGAATGAGCTGAGACAATCAAAACCACCAAACCCGCAGCCACCACAGAGGCCACCTATAGATCCGTGGACGAGATCTCGGCTTACACGGCAAATGGCACCCCCTAAAGAAGATAAAAGCTCTGATTCCGATAATTGA

Network for GWHGAAZE008054

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01196.20	Ribosomal_L17	5	59	1.00E-14

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02879	RP-L17, MRPL17, rplQ	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	40.701
	SRR3591706	second leaf	20.474
	SRR3591707	mature leaf	14.775
	SRR3591708	Shoot apex	44.827
	SRR3591709	Stem	27.396
	SRR3591710	White floral bud	24.587
	SRR3591711	White flower	41.690
	SRR3591712	Green floral bud	38.817
	SRR3591713	Yellow flower	32.219
SRP173429	SRR8316895	Juvenile bud stage	41.478
	SRR8316896	Juvenile bud stage	63.948
	SRR8316897	Juvenile bud stage	27.481
	SRR8316894	Third green stage	22.220
	SRR8316900	Third green stage	63.599
	SRR8316901	Third green stage	65.435
	SRR8316898	Complete white stage	26.855
	SRR8316899	Complete white stage	69.461
	SRR8316903	Complete white stage	33.671
	SRR8316902	Silver flowering stage	26.601
	SRR8316904	Silver flowering stage	27.278
	SRR8316905	Silver flowering stage	13.715
	SRR8316906	Gold flowering stage	53.155
	SRR8316907	Gold flowering stage	56.589
	SRR8316908	Gold flowering stage	41.496
SRP132670	SRR6706286	Control	56.272
	SRR6706287	Light intensity 50%	51.115
	SRR6706288	Light intensity 20%	52.957
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	72.483
	CNS0095593	Slightly white alabastrum(diploid) 2	67.757
	CNS0095594	Slightly white alabastrum(diploid) 3	75.695
	CNS0095595	Whole white alabastrum(diploid) 2	50.632
	CNS0095596	Whole white alabastrum(diploid) 3	54.093
	CNS0095597	Whole white alabastrum(diploid) 4	52.533
	CNS0095598	Silvery flower (diploied) 1	58.764
	CNS0095599	Silvery flower (diploied) 2	47.950
	CNS0095600	Silvery flower (diploied) 3	52.019
	CNS0095601	Golden flower (diploid) 1	45.741
	CNS0095602	Golden flower (diploid) 2	50.982
	CNS0095603	Golden flower (diploid) 3	44.212
	CNS0095604	Slightly white alabastrum(tetraploid) 1	75.064
	CNS0095605	Slightly white alabastrum(tetraploid) 2	64.299
	CNS0095606	Slightly white alabastrum(tetraploid) 3	77.658
	CNS0095607	Whole white alabastrum(tetraploid) 1	49.571
	CNS0095608	Whole white alabastrum(tetraploid) 2	46.472
	CNS0095609	Whole white alabastrum(tetraploid) 3	61.400
	CNS0095610	Silvery flower (tetraploid) 1	59.668
	CNS0095611	Silvery flower (tetraploid) 2	44.617
	CNS0095612	Silvery flower (tetraploid) 3	40.786
	CNS0095613	Golden flower (tetraploid) 1	31.901
	CNS0095614	Golden flower (tetraploid) 2	47.317
	CNS0095615	Golden flower (tetraploid) 3	20.106
CRA001975	CRR073297	Stem 1	54.617
	CRR073298	Stem 2	52.918
	CRR073299	Stem 3	49.926
	CRR073300	Leaf 1	47.739
	CRR073301	Leaf 2	56.534
	CRR073302	Leaf 3	53.848
	CRR073303	Juvenile bud 1	61.829
	CRR073304	Juvenile bud 2	45.009
	CRR073305	Juvenile bud 3	52.610
	CRR073306	Third green 1	24.438
	CRR073307	Third green 2	21.917
	CRR073308	Third green 3	23.079
	CRR073309	Second white 1	22.186
	CRR073310	Second white 2	25.660
	CRR073311	Second white 3	11.681
	CRR073312	Silver flowering 1	16.756
	CRR073313	Silver flowering 2	21.117
	CRR073314	Silver flowering 3	19.507
	CRR073315	Gold flowering 1	17.898
	CRR073316	Gold flowering 2	20.752
	CRR073317	Gold flowering 3	20.976
	CRR073318	Tawny withering 1	51.647
	CRR073319	Tawny withering 2	36.923
	CRR073320	Tawny withering 3	47.700